Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI37268
Trapped Gene
Rprd2 (ENSMUSG00000028106)
Vector Insertion
Chr 3: 95589030 - 95590242
Public Clones CMHD-GT_462G10-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 38% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000176217 (Chr3:95590243..95590320 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAACCGAATAAGCAGTGGAA Chr3:95590254..95590273 58.77 45 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000176217 (Chr3:95590243..95590320 -)
Downstram Exon
ENSMUSE00000176223 (Chr3:95588977..95589029 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAACCGAATAAGCAGTGGAA Chr3:95590254..95590273 58.77 45 CAGCTTTTGGATTCGTGGAT Chr3:95588987..95589006 60.07 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000566196 Chr3:95622470..95622876 GGCTTGTCGTCCTGGTGTAT Chr3:95622529..95622548 60 55
upstream ENSMUSE00000176218 Chr3:95594023..95594152 TCCCCATCGTTTGAATCTCT Chr3:95594126..95594145 59.48 45
upstream ENSMUSE00000392753 Chr3:95591207..95591307 TCTGGGAAGATCGAAATGTG Chr3:95591247..95591266 58.64 45
upstream ENSMUSE00000176217 Chr3:95590243..95590320 CAACCGAATAAGCAGTGGAA Chr3:95590254..95590273 58.77 45
upstream ENSMUSE00000566202 Chr3:95590243..95590374 CCATAATGCCAGACTGCAAA Chr3:95590339..95590358 59.69 45

*** Putative Vector Insertion (Chr 3: 95589030 - 95590242) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000176223 Chr3:95588977..95589029 CAGCTTTTGGATTCGTGGAT Chr3:95588987..95589006 60.07 45
downstream ENSMUSE00000393155 Chr3:95588137..95588263 CTCTTCAATGAGGGCCTGAG Chr3:95588221..95588240 59.94 55
downstream ENSMUSE00000448226 Chr3:95584338..95584513 CTGTTAGTGAGGGCCCATTT Chr3:95584381..95584400 59.05 50
downstream ENSMUSE00000448220 Chr3:95580438..95580720 CTCGGTTAGCGAAGGTTTTG Chr3:95580674..95580693 59.88 50
downstream ENSMUSE00000448213 Chr3:95578183..95578295 ACCAGTGGAGACAGCAGGTT Chr3:95578224..95578243 59.76 55
downstream ENSMUSE00000448268 Chr3:95578064..95578180 AAAACCAAAGTTGGGGAAGG Chr3:95578090..95578109 60.19 45
downstream ENSMUSE00000566199 Chr3:95578035..95578295 AAAACCAAAGTTGGGGAAGG Chr3:95578090..95578109 60.19 45
downstream ENSMUSE00000566198 Chr3:95575919..95576119 GTTGCTGGGACTGGTAGGAA Chr3:95576045..95576064 60.11 55
downstream ENSMUSE00000566197 Chr3:95563796..95570343 ACAGCTGAGGCCTAACTCCA Chr3:95564490..95564509 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAACCGAATAAGCAGTGGAA Chr3:95590252..95590272 58.77 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAACCGAATAAGCAGTGGAA Chr3:95590252..95590272 58.77 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028106