Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI3727
Trapped Gene
Gtpbp4 (ENSMUSG00000021149)
Vector Insertion
Chr 13: 8979226 - 8984454
Public Clones XS0981 (sanger) AE0475 (sanger) IST13405E4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 59% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000252316 (Chr13:8984455..8984565 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000252316 (Chr13:8984455..8984565 -)
Downstram Exon
ENSMUSE00000252305 (Chr13:8979148..8979225 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000477746 Chr13:8995195..8995263 No primer for this exon
upstream ENSMUSE00000115107 Chr13:8991891..8992061 No primer for this exon
upstream ENSMUSE00000115082 Chr13:8991178..8991281 No primer for this exon
upstream ENSMUSE00000115106 Chr13:8990961..8991097 No primer for this exon
upstream ENSMUSE00000115095 Chr13:8989944..8990044 No primer for this exon
upstream ENSMUSE00000115084 Chr13:8988299..8988391 No primer for this exon
upstream ENSMUSE00000115089 Chr13:8987002..8987193 No primer for this exon
upstream ENSMUSE00000115087 Chr13:8986495..8986560 No primer for this exon
upstream ENSMUSE00000115097 Chr13:8984884..8984973 No primer for this exon
upstream ENSMUSE00000252316 Chr13:8984455..8984565 No primer for this exon

*** Putative Vector Insertion (Chr 13: 8979226 - 8984454) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000252305 Chr13:8979148..8979225 No primer for this exon
downstream ENSMUSE00000252297 Chr13:8978675..8978726 No primer for this exon
downstream ENSMUSE00000115101 Chr13:8977774..8977874 No primer for this exon
downstream ENSMUSE00000462027 Chr13:8976482..8976679 No primer for this exon
downstream ENSMUSE00000115086 Chr13:8974191..8974256 No primer for this exon
downstream ENSMUSE00000115104 Chr13:8973410..8973553 No primer for this exon
downstream ENSMUSE00000454482 Chr13:8971317..8972520 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr13:8984383..8984403 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGTGCCCAACAAGAGAGATG Chr13:8981458..8981478 59.83 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TCGATTGGCTTTGTTTGTGA Chr13:8984587..8984607 60.23 40 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TGTGCTTTCTTAGGCGTGTG Chr13:8981557..8981577 60.05 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000021149