Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI37283
Trapped Gene
Cpne5 (ENSMUSG00000024008)
Vector Insertion
Chr 17: 29299317 - 29299380
Public Clones CMHD-GT_462B8-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 58% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000368564 (Chr17:29299318..29299379 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AATCCCTCACAGTCCACGTC Chr17:29299358..29299377 59.97 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000368564 (Chr17:29299318..29299379 -)
Downstram Exon
ENSMUSE00000549058 (Chr17:29299198..29299379 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AATCCCTCACAGTCCACGTC Chr17:29299358..29299377 59.97 55 GACGTGGACTGTGAGGGATT Chr17:29299336..29299355 59.97 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000718983 Chr17:29374558..29374742 AATCGCGCAGGAATATTGAC Chr17:29374684..29374703 60.07 45
upstream ENSMUSE00000721728 Chr17:29374558..29374742 AATCGCGCAGGAATATTGAC Chr17:29374684..29374703 60.07 45
upstream ENSMUSE00000549087 Chr17:29363138..29363178 No primer for this exon
upstream ENSMUSE00000609784 Chr17:29363138..29363178 No primer for this exon
upstream ENSMUSE00000549084 Chr17:29362136..29362182 AAGGGATGGAGAACAAGCAA Chr17:29362145..29362164 59.67 45
upstream ENSMUSE00000609783 Chr17:29362136..29362182 AAGGGATGGAGAACAAGCAA Chr17:29362145..29362164 59.67 45
upstream ENSMUSE00000549083 Chr17:29348593..29348696 CAGAACCTCCGCTTTGATCT Chr17:29348593..29348612 59.43 50
upstream ENSMUSE00000609782 Chr17:29348593..29348696 CAGAACCTCCGCTTTGATCT Chr17:29348593..29348612 59.43 50
upstream ENSMUSE00000549081 Chr17:29346635..29346674 CCAAGAGCCCGGATCTATCT Chr17:29346641..29346660 60.56 55
upstream ENSMUSE00000609781 Chr17:29346635..29346674 CCAAGAGCCCGGATCTATCT Chr17:29346641..29346660 60.56 55
upstream ENSMUSE00000549080 Chr17:29346369..29346445 GGCCTTCTGTACCCTTGGAG Chr17:29346412..29346431 61.01 60
upstream ENSMUSE00000609780 Chr17:29346369..29346445 GGCCTTCTGTACCCTTGGAG Chr17:29346412..29346431 61.01 60
upstream ENSMUSE00000549078 Chr17:29341634..29341693 GGAACATTCAGCCTCAACTCC Chr17:29341669..29341689 61.01 52.38
upstream ENSMUSE00000609779 Chr17:29341634..29341693 GGAACATTCAGCCTCAACTCC Chr17:29341669..29341689 61.01 52.38
upstream ENSMUSE00000549077 Chr17:29339450..29339513 CCCAGGGAAGAAATGTGGTA Chr17:29339488..29339507 59.78 50
upstream ENSMUSE00000609778 Chr17:29339450..29339513 CCCAGGGAAGAAATGTGGTA Chr17:29339488..29339507 59.78 50
upstream ENSMUSE00000549076 Chr17:29325238..29325341 TGTGCCAACAAGCTGGATAA Chr17:29325301..29325320 60.26 45
upstream ENSMUSE00000609777 Chr17:29325238..29325341 TGTGCCAACAAGCTGGATAA Chr17:29325301..29325320 60.26 45
upstream ENSMUSE00000549047 Chr17:29320868..29320972 GCTCTGTGCAACGGAGACTA Chr17:29320874..29320893 59.19 55
upstream ENSMUSE00000549073 Chr17:29320868..29320972 GCTCTGTGCAACGGAGACTA Chr17:29320874..29320893 59.19 55
upstream ENSMUSE00000137207 Chr17:29313107..29313148 AGGTGTATGACTGGGATCGTG Chr17:29313114..29313134 59.86 52.38
upstream ENSMUSE00000549069 Chr17:29310270..29310345 CCATGACTTCATTGGGGAGT Chr17:29310326..29310345 59.78 50
upstream ENSMUSE00000137215 Chr17:29306350..29306403 No primer for this exon
upstream ENSMUSE00000549066 Chr17:29303663..29303724 TGCTTTCCTTTGCGGTAGAG Chr17:29303698..29303717 60.51 50
upstream ENSMUSE00000549062 Chr17:29301619..29301665 No primer for this exon
upstream ENSMUSE00000368564 Chr17:29299318..29299379 AATCCCTCACAGTCCACGTC Chr17:29299358..29299377 59.97 55

*** Putative Vector Insertion (Chr 17: 29299317 - 29299380) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000609776 Chr17:29299277..29299315 TCATAATGCTGAATGATCTCTCC Chr17:29299255..29299277 58.29 39.13
downstream ENSMUSE00000549058 Chr17:29299198..29299379 GACGTGGACTGTGAGGGATT Chr17:29299336..29299355 59.97 55
downstream ENSMUSE00000237233 Chr17:29298364..29298491 CAAAGTTAGTGGGGCCGTAA Chr17:29298367..29298386 59.99 50
downstream ENSMUSE00000137211 Chr17:29298055..29298157 CCGAGATGACACCATCAGTG Chr17:29298065..29298084 60.11 55
downstream ENSMUSE00000137218 Chr17:29297264..29297321 TGATCGACATAGGGAGTTTGG Chr17:29297275..29297295 59.94 47.62
downstream ENSMUSE00000137213 Chr17:29296897..29296970 CTGGACAATGTCTCGCTCAG Chr17:29296875..29296894 59.57 55
downstream ENSMUSE00000356211 Chr17:29293497..29296185 AGGGGCTCTATCTGCTCACA Chr17:29295549..29295568 59.97 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CACGTCCCTCCACTACATGA Chr17:29299342..29299362 59.54 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CACGTCCCTCCACTACATGA Chr17:29299342..29299362 59.54 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024008