Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI37292
Trapped Gene
A430093F15Rik (ENSMUSG00000067577)
Vector Insertion
Chr 19: 10859836 - 10859907
Public Clones CMHD-GT_449A2-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 45% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000452651 (Chr19:10859723..10859835 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCAGGGCAGACTCTCAAAGC Chr19:10859800..10859819 60.68 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000452651 (Chr19:10859723..10859835 +)
Downstram Exon
ENSMUSE00000549123 (Chr19:10859908..10860533 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCAGGGCAGACTCTCAAAGC Chr19:10859800..10859819 60.68 55 GGATGCAATCAGGGTCAAGT Chr19:10860316..10860335 59.93 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000621261 Chr19:10815437..10815492 GGACAGGCTCTGCCCTATTG Chr19:10815458..10815477 62.07 60
upstream ENSMUSE00000549124 Chr19:10856252..10857571 ATTGACTGGCCTCTGGATTG Chr19:10857303..10857322 60.07 50
upstream ENSMUSE00000452651 Chr19:10859723..10859835 TCAGGGCAGACTCTCAAAGC Chr19:10859800..10859819 60.68 55

*** Putative Vector Insertion (Chr 19: 10859836 - 10859907) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000549123 Chr19:10859908..10860533 GGATGCAATCAGGGTCAAGT Chr19:10860316..10860335 59.93 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGCTCAGTTTCCTTGGATGG Chr19:10859818..10859838 59.28 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCTGAGCTGATCGTGACTGG Chr19:10859876..10859896 60.14 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000067577