Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI37295
Trapped Gene
St6galnac6 (ENSMUSG00000026811)
Vector Insertion
Chr 2: 32467924 - 32470300
Public Clones CMHD-GT_260C8-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 59% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000706814 (Chr2:32467744..32467923 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTCTTTGCCCTCATCACCAT Chr2:32467771..32467790 60.07 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000706814 (Chr2:32467744..32467923 +)
Downstram Exon
ENSMUSE00000695042 (Chr2:32470301..32470440 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTCTTTGCCCTCATCACCAT Chr2:32467771..32467790 60.07 50 TGATCACACACTGGTTGCAC Chr2:32470337..32470356 59.1 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000603960 Chr2:32455229..32455356 GTTGGCACAGCGTCTACTGA Chr2:32455272..32455291 60.06 55
upstream ENSMUSE00000695046 Chr2:32462481..32462631 No primer for this exon
upstream ENSMUSE00000695044 Chr2:32462531..32462631 No primer for this exon
upstream ENSMUSE00000706813 Chr2:32462531..32462625 No primer for this exon
upstream ENSMUSE00000695049 Chr2:32462546..32462631 No primer for this exon
upstream ENSMUSE00000695040 Chr2:32463556..32463745 GAACCGTAGTCCTGGCTGAG Chr2:32463708..32463727 59.87 60
upstream ENSMUSE00000695043 Chr2:32463562..32463745 GAACCGTAGTCCTGGCTGAG Chr2:32463708..32463727 59.87 60
upstream ENSMUSE00000695048 Chr2:32463562..32463616 GAGAGGTCACATGGCTTGCT Chr2:32463581..32463600 60.42 55
upstream ENSMUSE00000163071 Chr2:32463591..32463616 No primer for this exon
upstream ENSMUSE00000645887 Chr2:32464046..32464077 No primer for this exon
upstream ENSMUSE00000645888 Chr2:32464746..32464836 ACGCCGGAGAGAGATGAGTA Chr2:32464809..32464828 59.97 55
upstream ENSMUSE00000695045 Chr2:32464746..32464836 ACGCCGGAGAGAGATGAGTA Chr2:32464809..32464828 59.97 55
upstream ENSMUSE00000722288 Chr2:32464746..32464836 ACGCCGGAGAGAGATGAGTA Chr2:32464809..32464828 59.97 55
upstream ENSMUSE00000706814 Chr2:32467744..32467923 CTCTTTGCCCTCATCACCAT Chr2:32467771..32467790 60.07 50

*** Putative Vector Insertion (Chr 2: 32467924 - 32470300) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000163077 Chr2:32470301..32470707 GGAAGAGGTCGTCAAACTGC Chr2:32470688..32470707 59.85 55
downstream ENSMUSE00000695042 Chr2:32470301..32470440 TGATCACACACTGGTTGCAC Chr2:32470337..32470356 59.1 50
downstream ENSMUSE00000163069 Chr2:32474017..32474124 GCACATGGTCACACAATTCC Chr2:32474093..32474112 59.82 50
downstream ENSMUSE00000480091 Chr2:32474860..32476324 AGAACCCAGTCCCCATCTCT Chr2:32476101..32476120 59.93 55
downstream ENSMUSE00000603954 Chr2:32474860..32476326 AGAACCCAGTCCCCATCTCT Chr2:32476101..32476120 59.93 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACTTCCCTATCCTCGGCAAC Chr2:32467902..32467922 60.46 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACTTCCCTATCCTCGGCAAC Chr2:32467902..32467922 60.46 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000026811