Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI37341
Trapped Gene
Armcx6 (ENSMUSG00000050394)
Vector Insertion
Chr X: 131285573 - 131285688
Public Clones CMHD-GT_425D9-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000694736 (ChrX:131285689..131285870 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTGGCGAATATGGGCTATGT ChrX:131285784..131285803 60.31 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000694736 (ChrX:131285689..131285870 -)
Downstram Exon
ENSMUSE00000349806 (ChrX:131285480..131285572 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTGGCGAATATGGGCTATGT ChrX:131285784..131285803 60.31 45 TCAGGATGAATCCCACCTTC ChrX:131285466..131285485 59.86 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000388158 ChrX:131285869..131285951 CTGGGTACCAACCCCCTATT ChrX:131285916..131285935 59.93 55
upstream ENSMUSE00000694736 ChrX:131285689..131285870 TTGGCGAATATGGGCTATGT ChrX:131285784..131285803 60.31 45

*** Putative Vector Insertion (Chr X: 131285573 - 131285688) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000349806 ChrX:131285480..131285572 TCAGGATGAATCCCACCTTC ChrX:131285466..131285485 59.86 50
downstream ENSMUSE00000353389 ChrX:131285090..131285169 ATTCCCTCCACGGAGATAGG ChrX:131285118..131285137 60.28 55
downstream ENSMUSE00000694735 ChrX:131283000..131284764 GGCTTCCACAAGCATCTCTC ChrX:131283704..131283723 59.96 55
downstream ENSMUSE00000371116 ChrX:131282994..131284764 GGCTTCCACAAGCATCTCTC ChrX:131283704..131283723 59.96 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGCACAAAATCCAAGCAAAG ChrX:131285651..131285671 59.85 40 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGCACAAAATCCAAGCAAAG ChrX:131285651..131285671 59.85 40 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000050394