Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI37345
Trapped Gene
Cyp2f2 (ENSMUSG00000052974)
Vector Insertion
Chr 7: 27917635 - 27918234
Public Clones CMHD-GT_443B8-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 88% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000433946 (Chr7:27917493..27917634 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAGACGCCTCAGGAGTTCAA Chr7:27917547..27917566 59.99 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000433946 (Chr7:27917493..27917634 +)
Downstram Exon
ENSMUSE00000434004 (Chr7:27918235..27918678 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAGACGCCTCAGGAGTTCAA Chr7:27917547..27917566 59.99 50 GTGAACCCCAACTGGAAGAA Chr7:27918464..27918483 59.94 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000517790 Chr7:27904974..27905034 GCAGCACACACAAGAACTTCA Chr7:27904987..27905007 60.09 47.62
upstream ENSMUSE00000433995 Chr7:27906570..27906760 AGACTTGCTGACCTCCCTCA Chr7:27906736..27906755 59.99 55
upstream ENSMUSE00000201219 Chr7:27906854..27907016 GCATACCCCGTCTTTTTCAA Chr7:27906980..27906999 59.94 45
upstream ENSMUSE00000433983 Chr7:27909873..27910022 GAACTTTGGCATGGGAAAAA Chr7:27909937..27909956 59.92 40
upstream ENSMUSE00000433977 Chr7:27914210..27914370 CGCTTCGACTATGACGATGA Chr7:27914284..27914303 59.97 50
upstream ENSMUSE00000309497 Chr7:27914736..27914912 GGACTTCATCGACTGCTTCC Chr7:27914876..27914895 59.81 55
upstream ENSMUSE00000413953 Chr7:27915313..27915454 GCTGATGACCACACACAACC Chr7:27915354..27915373 60.01 55
upstream ENSMUSE00000394430 Chr7:27916189..27916376 ACGCTGGAAGACCGTACATC Chr7:27916239..27916258 60.14 55
upstream ENSMUSE00000433946 Chr7:27917493..27917634 AAGACGCCTCAGGAGTTCAA Chr7:27917547..27917566 59.99 50

*** Putative Vector Insertion (Chr 7: 27917635 - 27918234) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000434004 Chr7:27918235..27918678 GTGAACCCCAACTGGAAGAA Chr7:27918464..27918483 59.94 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCGGCTGGTAAGAGATGGAG Chr7:27917629..27917649 60.35 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCGGCTGGTAAGAGATGGAG Chr7:27917629..27917649 60.35 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000052974