Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI37355
Trapped Gene
Lasp1 (ENSMUSG00000038366)
Vector Insertion
Chr 11: 97686264 - 97694859
Public Clones PST23600-NL (escells) PST20763-NR (escells) PST22839-NL (escells) PST26273-NR (escells)
Private Clones not available
Severity of mutation (?) Insertion after 45% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000505619 (Chr11:97686156..97686263 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCGCTACAAGGAGGAATTTG Chr11:97686158..97686177 59.85 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000505619 (Chr11:97686156..97686263 +)
Downstram Exon
ENSMUSE00000722091 (Chr11:97694860..97695016 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCGCTACAAGGAGGAATTTG Chr11:97686158..97686177 59.85 50 ACTGGTCGGGATATGGTGAG Chr11:97695012..97695031 59.8 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000673695 Chr11:97660983..97661176 CGGAACCATGAACCCTAACT Chr11:97661101..97661120 58.91 50
upstream ENSMUSE00000347026 Chr11:97660986..97661176 CGGAACCATGAACCCTAACT Chr11:97661101..97661120 58.91 50
upstream ENSMUSE00000673683 Chr11:97660989..97661176 CGGAACCATGAACCCTAACT Chr11:97661101..97661120 58.91 50
upstream ENSMUSE00000285055 Chr11:97668139..97668233 ATGCTTTCACTGCGAGACCT Chr11:97668153..97668172 60.02 50
upstream ENSMUSE00000673680 Chr11:97668139..97668243 ACTGCAATGCGTGAGTTTTG Chr11:97668224..97668243 59.91 45
upstream ENSMUSE00000673691 Chr11:97668139..97668233 ATGCTTTCACTGCGAGACCT Chr11:97668153..97668172 60.02 50
upstream ENSMUSE00000285046 Chr11:97677012..97677096 AACAGAGCGAGCTGCAGAGT Chr11:97677074..97677093 60.5 55
upstream ENSMUSE00000673679 Chr11:97677021..97677096 AACAGAGCGAGCTGCAGAGT Chr11:97677074..97677093 60.5 55
upstream ENSMUSE00000505619 Chr11:97686156..97686263 GCGCTACAAGGAGGAATTTG Chr11:97686158..97686177 59.85 50
upstream ENSMUSE00000673676 Chr11:97686156..97686234 GCGCTACAAGGAGGAATTTG Chr11:97686158..97686177 59.85 50

*** Putative Vector Insertion (Chr 11: 97686264 - 97694859) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000673674 Chr11:97694738..97695016 ACTGGTCGGGATATGGTGAG Chr11:97695012..97695031 59.8 55
downstream ENSMUSE00000718694 Chr11:97694860..97695016 ACTGGTCGGGATATGGTGAG Chr11:97695012..97695031 59.8 55
downstream ENSMUSE00000722091 Chr11:97694860..97695016 ACTGGTCGGGATATGGTGAG Chr11:97695012..97695031 59.8 55
downstream ENSMUSE00000285023 Chr11:97695398..97695501 CCACCATAGGACGAGGTCAT Chr11:97695446..97695465 59.8 55
downstream ENSMUSE00000673673 Chr11:97695398..97695698 CCACCATAGGACGAGGTCAT Chr11:97695446..97695465 59.8 55
downstream ENSMUSE00000673689 Chr11:97695398..97695501 CCACCATAGGACGAGGTCAT Chr11:97695446..97695465 59.8 55
downstream ENSMUSE00000356471 Chr11:97697386..97700076 CCTCAGACACGACGACAGAA Chr11:97698772..97698791 60.02 55
downstream ENSMUSE00000673686 Chr11:97697386..97699291 CCTCAGACACGACGACAGAA Chr11:97698772..97698791 60.02 55
downstream ENSMUSE00000673684 Chr11:97700028..97700076 No primer for this exon
downstream ENSMUSE00000673675 Chr11:97736253..97736277 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAGCCCAGTGACAGAATGTG Chr11:97686244..97686264 60.31 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCTGAGCTGCAGAGAATCAA Chr11:97686220..97686240 59.27 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038366