Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI374
Trapped Gene
Bclaf1 (ENSMUSG00000037608)
Vector Insertion
Chr 10: 20032274 - 20032411
Public Clones GC1110 (tigem) XG324 (baygenomics) RST161 (baygenomics) XE222 (baygenomics)
XE071 (baygenomics) RST211 (baygenomics) D040F08 (ggtc) W066C08 (ggtc)
Q997F12 (ggtc) A061C01 (ggtc) P106C06 (ggtc) Q020B07 (ggtc) W224E03 (ggtc)
W066F06 (ggtc) P007C11 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000484704 (Chr10:20032275..20032410 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAAATGGCCGCTGTGTAGTT Chr10:20032345..20032364 60.14 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000484704 (Chr10:20032275..20032410 +)
Downstram Exon
ENSMUSE00000705467 (Chr10:20032278..20032410 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAAATGGCCGCTGTGTAGTT Chr10:20032345..20032364 60.14 50 CAGGGTTTACCTCCGTGCTA Chr10:20032386..20032405 60.12 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC

*** Putative Vector Insertion (Chr 10: 20032274 - 20032411) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000484704 Chr10:20032275..20032410 CAGGGTTTACCTCCGTGCTA Chr10:20032386..20032405 60.12 55
downstream ENSMUSE00000705467 Chr10:20032278..20032410 CAGGGTTTACCTCCGTGCTA Chr10:20032386..20032405 60.12 55
downstream ENSMUSE00000099625 Chr10:20037814..20037917 TCTGCAGGATCCAGAAGTCA Chr10:20037911..20037930 59.5 50
downstream ENSMUSE00000099624 Chr10:20041809..20041922 No primer for this exon
downstream ENSMUSE00000412631 Chr10:20042769..20043674 TTCTTCGTGATGGGATGTGA Chr10:20043562..20043581 60.05 45
downstream ENSMUSE00000487284 Chr10:20042775..20043674 TTCTTCGTGATGGGATGTGA Chr10:20043562..20043581 60.05 45
downstream ENSMUSE00000615778 Chr10:20044946..20045611 CCTCCTCAGTATTCCGGTGA Chr10:20045232..20045251 60.06 55
downstream ENSMUSE00000615777 Chr10:20045736..20045905 CAGAATGGACAAGCGTGCTA Chr10:20045791..20045810 60.01 50
downstream ENSMUSE00000615776 Chr10:20047908..20048013 TGTATCTCGGGGCTCTTTTG Chr10:20048013..20048032 60.21 50
downstream ENSMUSE00000615775 Chr10:20049116..20049200 CGCTGGGAGAGATGTCAATC Chr10:20049141..20049160 60.77 55
downstream ENSMUSE00000615774 Chr10:20051892..20052067 GGAATCTCCCCGCTCTTTAC Chr10:20051984..20052003 60.04 55
downstream ENSMUSE00000577177 Chr10:20052202..20052363 TCCAACCTCCTGATGTAGCC Chr10:20052333..20052352 60.07 55
downstream ENSMUSE00000577184 Chr10:20053198..20053378 ATGGTCCCGCTCTCTACCTT Chr10:20053228..20053247 60.1 55
downstream ENSMUSE00000705466 Chr10:20053198..20053378 ATGGTCCCGCTCTCTACCTT Chr10:20053228..20053247 60.1 55
downstream ENSMUSE00000577183 Chr10:20054305..20054451 TGTCCCAGCAAAAACTCCTC Chr10:20054355..20054374 60.23 50
downstream ENSMUSE00000577180 Chr10:20059515..20059727 TTCCTCTTTTGGCCCAGTAA Chr10:20059563..20059582 59.68 45
downstream ENSMUSE00000705465 Chr10:20059515..20059727 TTCCTCTTTTGGCCCAGTAA Chr10:20059563..20059582 59.68 45
downstream ENSMUSE00000577179 Chr10:20059858..20062307 AGGGGAGCATCATGCAATAC Chr10:20061332..20061351 59.92 50
downstream ENSMUSE00000705464 Chr10:20059858..20060072 TCTGCTCCCTGTTGCAATCT Chr10:20059891..20059910 60.94 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATGGTCTAATCGCCTTGCAG Chr10:20032319..20032339 60.24 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000037608