Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI37410
Trapped Gene
Trim71 (ENSMUSG00000079259)
Vector Insertion
Chr 9: 114420392 - 114424986
Public Clones PST23688-NR (escells) PST17433-NR (escells) PST17073-NL (escells)
Private Clones not available
Severity of mutation (?) Insertion after 44% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000689094 (Chr9:114424851..114424985 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTGGCAGAACAGGTGGAGAT Chr9:114424942..114424961 60.12 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000689094 (Chr9:114424851..114424985 -)
Downstram Exon
ENSMUSE00000689092 (Chr9:114420393..114423214 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTGGCAGAACAGGTGGAGAT Chr9:114424942..114424961 60.12 55 ATTCTGCTGGTCGCTCACTT Chr9:114422713..114422732 60.02 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000689096 Chr9:114471423..114473487 GGGGAGTCGTGCAAAATAAA Chr9:114473347..114473366 59.94 45
upstream ENSMUSE00000689095 Chr9:114434072..114434239 CTGTGACACCTGCTCTGTCC Chr9:114434206..114434225 59.44 60
upstream ENSMUSE00000689094 Chr9:114424851..114424985 GTGGCAGAACAGGTGGAGAT Chr9:114424942..114424961 60.12 55
upstream ENSMUSE00000689092 Chr9:114420393..114423214 AAGTGAGCGACCAGCAGAAT Chr9:114422735..114422754 60.02 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTGGCAGAACAGGTGGAGAT Chr9:114421940..114421960 60.12 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTGGCAGAACAGGTGGAGAT Chr9:114421940..114421960 60.12 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000079259