Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI37452
Trapped Gene
Acin1 (ENSMUSG00000022185)
Vector Insertion
Chr 14: 55263520 - 55264194
Public Clones PST21526-NR (escells)
Private Clones not available
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000124227 (Chr14:55264048..55264193 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCAGGGGCAAGATCAGTAAC Chr14:55264069..55264088 59.55 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000124227 (Chr14:55264048..55264193 -)
Downstram Exon
ENSMUSE00000124237 (Chr14:55263521..55263628 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCAGGGGCAAGATCAGTAAC Chr14:55264069..55264088 59.55 55 GTTCCTGTACGCCCCAATAA Chr14:55263554..55263573 59.82 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000718451 Chr14:55305306..55305768 CCGAGTACCTCACGCAAGAT Chr14:55305442..55305461 60.28 55
upstream ENSMUSE00000719507 Chr14:55305306..55305768 CCGAGTACCTCACGCAAGAT Chr14:55305442..55305461 60.28 55
upstream ENSMUSE00000124207 Chr14:55303848..55303913 AACACTCAACACCCCATGCT Chr14:55303869..55303888 60.43 50
upstream ENSMUSE00000688014 Chr14:55303848..55303913 AACACTCAACACCCCATGCT Chr14:55303869..55303888 60.43 50
upstream ENSMUSE00000124223 Chr14:55298078..55298189 GGAGGAAATGAGCCAGAACA Chr14:55298165..55298184 60.19 50
upstream ENSMUSE00000688012 Chr14:55298078..55298189 GGAGGAAATGAGCCAGAACA Chr14:55298165..55298184 60.19 50
upstream ENSMUSE00000321744 Chr14:55297580..55297699 GAGTCGGAGGACGAGATGAC Chr14:55297669..55297688 59.8 60
upstream ENSMUSE00000688011 Chr14:55297580..55297699 GAGTCGGAGGACGAGATGAC Chr14:55297669..55297688 59.8 60
upstream ENSMUSE00000648754 Chr14:55294642..55294682 GATCCCTGGAGCTGGAATTA Chr14:55294653..55294672 59.08 50
upstream ENSMUSE00000429548 Chr14:55285910..55285998 GGGAAAGACGATCATCCAGA Chr14:55285919..55285938 60.01 50
upstream ENSMUSE00000688010 Chr14:55285910..55285998 GGGAAAGACGATCATCCAGA Chr14:55285919..55285938 60.01 50
upstream ENSMUSE00000321740 Chr14:55283209..55284471 AGGGTCAGAGCAGATCGAAA Chr14:55284377..55284396 59.95 50
upstream ENSMUSE00000688009 Chr14:55283209..55284471 AGGGTCAGAGCAGATCGAAA Chr14:55284377..55284396 59.95 50
upstream ENSMUSE00000124230 Chr14:55282424..55282642 CAACAGCACGTGATCCAGAG Chr14:55282440..55282459 60.46 55
upstream ENSMUSE00000688008 Chr14:55282424..55282642 CAACAGCACGTGATCCAGAG Chr14:55282440..55282459 60.46 55
upstream ENSMUSE00000124239 Chr14:55281005..55281120 AGCCCAAAGAAGTGTGAAGC Chr14:55281098..55281117 59.48 50
upstream ENSMUSE00000688007 Chr14:55281005..55281120 AGCCCAAAGAAGTGTGAAGC Chr14:55281098..55281117 59.48 50
upstream ENSMUSE00000429506 Chr14:55272051..55272076 No primer for this exon
upstream ENSMUSE00000464877 Chr14:55270554..55270695 GCAGACCAAGTCAGCAATGA Chr14:55270597..55270616 59.99 50
upstream ENSMUSE00000688006 Chr14:55270554..55270695 GCAGACCAAGTCAGCAATGA Chr14:55270597..55270616 59.99 50
upstream ENSMUSE00000124218 Chr14:55266925..55266967 AGTTCGATGCCCAAGTCATT Chr14:55266948..55266967 59.56 45
upstream ENSMUSE00000124232 Chr14:55265540..55265673 GTGCAAGCTGGAAACAGTGA Chr14:55265640..55265659 60.03 50
upstream ENSMUSE00000124221 Chr14:55265288..55265440 TATGCCGGACAGTCACTCAG Chr14:55265288..55265307 59.85 55
upstream ENSMUSE00000124216 Chr14:55264442..55264580 CCTGTGGAGCACGAAGTAAA Chr14:55264447..55264466 58.92 50
upstream ENSMUSE00000124227 Chr14:55264048..55264193 CCAGGGGCAAGATCAGTAAC Chr14:55264069..55264088 59.55 55
upstream ENSMUSE00000124237 Chr14:55263521..55263628 TTATTGGGGCGTACAGGAAC Chr14:55263576..55263595 59.82 50

*** Putative Vector Insertion (Chr 14: 55263520 - 55264194) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000688005 Chr14:55263330..55263392 GCAACGGCTTCCTCTACTGT Chr14:55263345..55263364 59.5 55
downstream ENSMUSE00000124205 Chr14:55263285..55263392 GCAACGGCTTCCTCTACTGT Chr14:55263345..55263364 59.5 55
downstream ENSMUSE00000124236 Chr14:55262778..55263102 AGAGTCCCCGGTGATAGTCC Chr14:55263059..55263078 60.34 60
downstream ENSMUSE00000688004 Chr14:55262778..55263002 GGGTCCCTCTCGAACTTTGT Chr14:55262832..55262851 60.49 55
downstream ENSMUSE00000124240 Chr14:55262561..55262661 GAGGGAGCCAATAGATGCAG Chr14:55262553..55262572 59.8 55
downstream ENSMUSE00000688003 Chr14:55262126..55262128 No primer for this exon
downstream ENSMUSE00000429455 Chr14:55261005..55261885 GAGCGTGGGACACTGGTTAT Chr14:55261243..55261262 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTCTAATCGCCTTGCAGCAC Chr14:55264126..55264146 60.94 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCATCAGCCAACAGAAGTCC Chr14:55264142..55264162 60.66 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022185