Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI37459
Trapped Gene
Gab3 (ENSMUSG00000032750)
Vector Insertion
Chr X: 72278509 - 72330097
Public Clones PST21242-NR (escells)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000698154 (ChrX:72330007..72330096 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGATGAGCACTGGTGACACT ChrX:72330061..72330080 58.67 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000698154 (ChrX:72330007..72330096 -)
Downstram Exon
ENSMUSE00000264981 (ChrX:72278510..72278813 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGATGAGCACTGGTGACACT ChrX:72330061..72330080 58.67 55 CGGGAAGTGGTCTTGACAAT ChrX:72278586..72278605 59.97 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000698154 ChrX:72330007..72330096 GGATGAGCACTGGTGACACT ChrX:72330061..72330080 58.67 55
upstream ENSMUSE00000708038 ChrX:72330007..72330244 CAGGATGAGCACTGGTGACA ChrX:72330063..72330082 60.9 55
upstream ENSMUSE00000716386 ChrX:72330007..72330244 CAGGATGAGCACTGGTGACA ChrX:72330063..72330082 60.9 55
upstream ENSMUSE00000264981 ChrX:72278510..72278813 AGCCCATCCGTGTGATAGAC ChrX:72278703..72278722 59.96 55
upstream ENSMUSE00000698187 ChrX:72278510..72278813 AGCCCATCCGTGTGATAGAC ChrX:72278703..72278722 59.96 55

*** Putative Vector Insertion (Chr X: 72278509 - 72330097) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000264974 ChrX:72271328..72271544 TGGCATGGTGTAGTCTTCCA ChrX:72271307..72271326 60.11 50
downstream ENSMUSE00000698186 ChrX:72271328..72271544 TGGCATGGTGTAGTCTTCCA ChrX:72271307..72271326 60.11 50
downstream ENSMUSE00000264965 ChrX:72270117..72270595 TACTGCTGTGCCCAGTCAAC ChrX:72270170..72270189 59.9 55
downstream ENSMUSE00000698184 ChrX:72270117..72270595 TACTGCTGTGCCCAGTCAAC ChrX:72270170..72270189 59.9 55
downstream ENSMUSE00000264958 ChrX:72250655..72250710 CTGAGCCGCTTATCTCTGTG ChrX:72250643..72250662 58.78 55
downstream ENSMUSE00000698181 ChrX:72250655..72250710 CTGAGCCGCTTATCTCTGTG ChrX:72250643..72250662 58.78 55
downstream ENSMUSE00000264949 ChrX:72249663..72249870 TGGGGCTTGAGATTTCTGTT ChrX:72249649..72249668 59.67 45
downstream ENSMUSE00000698177 ChrX:72249663..72249870 TGGGGCTTGAGATTTCTGTT ChrX:72249649..72249668 59.67 45
downstream ENSMUSE00000264941 ChrX:72247150..72247231 TGGAAAGGTTTCTCGAGTCC ChrX:72247174..72247193 59.26 50
downstream ENSMUSE00000264932 ChrX:72245304..72245439 No primer for this exon
downstream ENSMUSE00000264925 ChrX:72235393..72235509 AGTCCAGGGCCAAATAATCC ChrX:72235403..72235422 60.15 50
downstream ENSMUSE00000698166 ChrX:72234063..72234175 ATCAGTCCATTCCTGCTTGG ChrX:72234058..72234077 60.07 50
downstream ENSMUSE00000698152 ChrX:72234043..72234175 ATCAGTCCATTCCTGCTTGG ChrX:72234058..72234077 60.07 50
downstream ENSMUSE00000551101 ChrX:72233889..72234175 ATCAGTCCATTCCTGCTTGG ChrX:72234058..72234077 60.07 50
downstream ENSMUSE00000698165 ChrX:72213183..72213324 TCATGACCAGGGAGAGTTGA ChrX:72213226..72213245 59.18 50
downstream ENSMUSE00000698164 ChrX:72212182..72213324 TGATCGCAAGGTAAGCACTG ChrX:72212699..72212718 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TATCTAATCGCCTTGCAGCAC ChrX:72327029..72327050 60.38 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTTTTCCCTTTCAACCCTACTG ChrX:72288120..72288142 59.51 40.91 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032750