Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI37489
Trapped Gene
2900010J23Rik (ENSMUSG00000044627)
Vector Insertion
Chr 2: 32138208 - 32143166
Public Clones (sanger) (sanger) PST18778-NR (escells)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000695434 (Chr2:32143117..32143165 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GACTTTACCATGGCGGCTAC Chr2:32143126..32143145 59.6 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000695434 (Chr2:32143117..32143165 -)
Downstram Exon
ENSMUSE00000695421 (Chr2:32138209..32138384 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GACTTTACCATGGCGGCTAC Chr2:32143126..32143145 59.6 55 GTTGGAGCTTGAGAGCTGGT Chr2:32138255..32138274 59.6 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000695437 Chr2:32143551..32143582 No primer for this exon
upstream ENSMUSE00000447349 Chr2:32143406..32143556 GTCTCCGTCGTCGGTTTCTA Chr2:32143498..32143517 60.26 55
upstream ENSMUSE00000695428 Chr2:32143406..32143533 GTCTCCGTCGTCGGTTTCTA Chr2:32143498..32143517 60.26 55
upstream ENSMUSE00000695434 Chr2:32143117..32143165 GACTTTACCATGGCGGCTAC Chr2:32143126..32143145 59.6 55
upstream ENSMUSE00000712502 Chr2:32143117..32143165 GACTTTACCATGGCGGCTAC Chr2:32143126..32143145 59.6 55
upstream ENSMUSE00000712656 Chr2:32143117..32143165 GACTTTACCATGGCGGCTAC Chr2:32143126..32143145 59.6 55
upstream ENSMUSE00000695421 Chr2:32138209..32138384 CAGCTCTCAAGCTCCAACAA Chr2:32138275..32138294 59.31 50

*** Putative Vector Insertion (Chr 2: 32138208 - 32143166) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000345216 Chr2:32137206..32137330 TCCTCGCTGACATCGTTATTC Chr2:32137262..32137282 60.23 47.62
downstream ENSMUSE00000695432 Chr2:32137206..32137330 TCCTCGCTGACATCGTTATTC Chr2:32137262..32137282 60.23 47.62
downstream ENSMUSE00000363891 Chr2:32136229..32136323 CAGCTCAATCACACGGTAGC Chr2:32136280..32136299 59.47 55
downstream ENSMUSE00000695426 Chr2:32134337..32134651 TCCAAGAAGCTGCTCAGTCA Chr2:32134552..32134571 59.85 50
downstream ENSMUSE00000447332 Chr2:32134336..32134651 TCCAAGAAGCTGCTCAGTCA Chr2:32134552..32134571 59.85 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTAACCCCATCCTCATCAGC Chr2:32143187..32143207 59.37 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTAACCCCATCCTCATCAGC Chr2:32143187..32143207 59.37 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000044627