Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI37504
Trapped Gene
Tjp2 (ENSMUSG00000024812)
Vector Insertion
Chr 19: 24188565 - 24194586
Public Clones PST16716-NR (escells) PST18008-NR (escells)
Private Clones not available
Severity of mutation (?) Insertion after 46% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000145178 (Chr19:24194435..24194585 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CACCAAAATGGTGAGGTTCA Chr19:24194560..24194579 59.39 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000145178 (Chr19:24194435..24194585 -)
Downstram Exon
ENSMUSE00000145203 (Chr19:24188566..24188674 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CACCAAAATGGTGAGGTTCA Chr19:24194560..24194579 59.39 45 CAGGTAGAGGACCGCATCTT Chr19:24188599..24188618 59.31 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000642336 Chr19:24248445..24248522 No primer for this exon
upstream ENSMUSE00000642338 Chr19:24213269..24213322 GGCATGGAGGAGGTGATATG Chr19:24213297..24213316 60.3 55
upstream ENSMUSE00000342686 Chr19:24209340..24209464 GAGACAACCCCCACTTTGAA Chr19:24209405..24209424 59.94 50
upstream ENSMUSE00000145185 Chr19:24207096..24207198 GGAAGATGTGCTCCATTCGT Chr19:24207140..24207159 60.08 50
upstream ENSMUSE00000145163 Chr19:24205345..24205963 GTCATGACGACCGAGGTTTT Chr19:24205886..24205905 59.97 50
upstream ENSMUSE00000145219 Chr19:24200195..24200298 CCTTCATGAGGGGGACATAA Chr19:24200203..24200222 59.74 50
upstream ENSMUSE00000145173 Chr19:24199058..24199211 CTCTAACGGATGCTCGGAAG Chr19:24199164..24199183 59.97 55
upstream ENSMUSE00000145211 Chr19:24196753..24196861 GAGGAGAGACGCCAGCAGTA Chr19:24196804..24196823 60.7 60
upstream ENSMUSE00000145171 Chr19:24196515..24196648 CCCAGGTACCAGGAAGAAGG Chr19:24196520..24196539 60.86 60
upstream ENSMUSE00000145168 Chr19:24195327..24195393 CGTCCTAGTCCCGAAGATGA Chr19:24195339..24195358 60.21 55
upstream ENSMUSE00000145178 Chr19:24194435..24194585 CACCAAAATGGTGAGGTTCA Chr19:24194560..24194579 59.39 45
upstream ENSMUSE00000145203 Chr19:24188566..24188674 AAGATGCGGTCCTCTACCTG Chr19:24188621..24188640 59.31 55

*** Putative Vector Insertion (Chr 19: 24188565 - 24194586) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000145215 Chr19:24187236..24187446 GCCATCGTACAGCGTGTCTA Chr19:24187285..24187304 59.9 55
downstream ENSMUSE00000145165 Chr19:24185916..24186109 TTGCGGAGGTTCTTCTTGAC Chr19:24185971..24185990 60.38 50
downstream ENSMUSE00000145225 Chr19:24185511..24185606 AGAACCACGGGTCTCTTGAA Chr19:24185560..24185579 59.7 50
downstream ENSMUSE00000145191 Chr19:24184221..24184300 CGGTATTCAACCGAACCACT Chr19:24184219..24184238 59.85 50
downstream ENSMUSE00000248590 Chr19:24183135..24183345 TTTTGAGCTTGTTGGCTTGA Chr19:24183137..24183156 59.58 40
downstream ENSMUSE00000248572 Chr19:24176387..24176487 CAGACTGCTTCGTTTTGCTG Chr19:24176381..24176400 59.78 50
downstream ENSMUSE00000248553 Chr19:24175192..24175404 TGAGACGGCTGTCACAACTC Chr19:24175295..24175314 60.03 55
downstream ENSMUSE00000145177 Chr19:24173943..24174053 CGGGCTAGCATCCCTAAGTT Chr19:24173951..24173970 60.59 55
downstream ENSMUSE00000145167 Chr19:24172491..24172805 GCTCTCAGGCATAGGGACTG Chr19:24172607..24172626 59.97 60
downstream ENSMUSE00000145188 Chr19:24171074..24171159 TTGGAACCGCATAGATGTCA Chr19:24171095..24171114 60.07 45
downstream ENSMUSE00000642335 Chr19:24169160..24170080 TTCCAGACAACGGACAAACA Chr19:24169230..24169249 60.13 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCAAAATGGTGAGGTTCAAGA Chr19:24194555..24194576 59.96 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCAAAATGGTGAGGTTCAAGA Chr19:24194555..24194576 59.96 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024812