Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI37520
Trapped Gene
Ddx42 (ENSMUSG00000020705)
Vector Insertion
Chr 11: 106104416 - 106106640
Public Clones PST17213-NR (escells)
Private Clones not available
Severity of mutation (?) Insertion after 68% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000108271 (Chr11:106104189..106104415 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000108271 (Chr11:106104189..106104415 +)
Downstram Exon
ENSMUSE00000108273 (Chr11:106106641..106106751 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000367069 Chr11:106078240..106078470 No primer for this exon
upstream ENSMUSE00000360968 Chr11:106085395..106085632 No primer for this exon
upstream ENSMUSE00000385834 Chr11:106086098..106086248 No primer for this exon
upstream ENSMUSE00000328098 Chr11:106090077..106090138 No primer for this exon
upstream ENSMUSE00000328092 Chr11:106091644..106091680 No primer for this exon
upstream ENSMUSE00000328087 Chr11:106092446..106092595 No primer for this exon
upstream ENSMUSE00000380490 Chr11:106094120..106094224 No primer for this exon
upstream ENSMUSE00000327928 Chr11:106096166..106096285 No primer for this exon
upstream ENSMUSE00000327922 Chr11:106096921..106097097 No primer for this exon
upstream ENSMUSE00000327917 Chr11:106098309..106098437 No primer for this exon
upstream ENSMUSE00000327910 Chr11:106099822..106099921 No primer for this exon
upstream ENSMUSE00000327900 Chr11:106100450..106100497 No primer for this exon
upstream ENSMUSE00000327891 Chr11:106101316..106101413 No primer for this exon
upstream ENSMUSE00000327880 Chr11:106102865..106103141 No primer for this exon
upstream ENSMUSE00000108271 Chr11:106104189..106104415 No primer for this exon

*** Putative Vector Insertion (Chr 11: 106104416 - 106106640) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000108273 Chr11:106106641..106106751 No primer for this exon
downstream ENSMUSE00000108270 Chr11:106108090..106108191 No primer for this exon
downstream ENSMUSE00000108278 Chr11:106108806..106110453 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGCAATGCAGGTAAGGGTTA Chr11:106104407..106104427 59.18 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGCAATGCAGGTAAGGGTTA Chr11:106104407..106104427 59.18 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020705