Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI37527
Trapped Gene
Ard1 (ENSMUSG00000031388)
Vector Insertion
Chr X: 71162812 - 71163267
Public Clones PST16212-NL (escells)
Private Clones not available
Severity of mutation (?) Insertion after 63% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000464900 (ChrX:71163182..71163266 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGAAGATGCGTATGCAATGA ChrX:71163211..71163230 59.65 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000464900 (ChrX:71163182..71163266 -)
Downstram Exon
ENSMUSE00000622462 (ChrX:71162813..71163266 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGAAGATGCGTATGCAATGA ChrX:71163211..71163230 59.65 45 GCCCCTGACCCTAGTAGTCC ChrX:71162843..71162862 59.96 65

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000485553 ChrX:71167095..71167184 GATGAACATCCGCAATGCTA ChrX:71167097..71167116 59.65 45
upstream ENSMUSE00000699153 ChrX:71167095..71167167 GATGAACATCCGCAATGCTA ChrX:71167097..71167116 59.65 45
upstream ENSMUSE00000699155 ChrX:71167095..71167227 GATGAACATCCGCAATGCTA ChrX:71167097..71167116 59.65 45
upstream ENSMUSE00000699159 ChrX:71167095..71167171 GATGAACATCCGCAATGCTA ChrX:71167097..71167116 59.65 45
upstream ENSMUSE00000270106 ChrX:71166611..71166709 GCCGGAGAACTACCAGATGA ChrX:71166646..71166665 60.22 55
upstream ENSMUSE00000209030 ChrX:71166322..71166380 GATTGTGGGCTACGTCTTGG ChrX:71166329..71166348 60.52 55
upstream ENSMUSE00000209025 ChrX:71165302..71165347 AAGAGGACCCAGACGATGTG ChrX:71165326..71165345 60.11 55
upstream ENSMUSE00000209029 ChrX:71165093..71165208 CCAAATACGTCTCCCTGCAT ChrX:71165104..71165123 59.96 50
upstream ENSMUSE00000209031 ChrX:71164841..71164885 TCCAACACCCTCAACTTTCA ChrX:71164841..71164860 59.11 45
upstream ENSMUSE00000699158 ChrX:71164841..71164879 TCCAACACCCTCAACTTTCA ChrX:71164841..71164860 59.11 45
upstream ENSMUSE00000464900 ChrX:71163182..71163266 GGAAGATGCGTATGCAATGA ChrX:71163211..71163230 59.65 45
upstream ENSMUSE00000622462 ChrX:71162813..71163266 AGTGGTGGCTAGAGGCAAGA ChrX:71163064..71163083 60.01 55

*** Putative Vector Insertion (Chr X: 71162812 - 71163267) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000647175 ChrX:71162298..71162534 AAGCACGTTGCCTTTGTTCT ChrX:71162423..71162442 59.92 45
downstream ENSMUSE00000332014 ChrX:71162259..71162534 AAGCACGTTGCCTTTGTTCT ChrX:71162423..71162442 59.92 45
downstream ENSMUSE00000699157 ChrX:71162229..71162625 AAGCACGTTGCCTTTGTTCT ChrX:71162423..71162442 59.92 45
downstream ENSMUSE00000699154 ChrX:71162226..71162621 AAGCACGTTGCCTTTGTTCT ChrX:71162423..71162442 59.92 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACCAGGAGAATTTGCCCCTA ChrX:71163291..71163311 60.82 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACCAGGAGAATTTGCCCCTA ChrX:71163291..71163311 60.82 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031388