Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI37550
Trapped Gene
Tmem32 (ENSMUSG00000061273)
Vector Insertion
Chr X: 53848620 - 53850961
Public Clones (egtc)
Private Clones not available
Severity of mutation (?) Insertion after 20% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000436074 (ChrX:53850962..53851096 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTGTAGGTGTCGGGCTTTTT ChrX:53850996..53851015 59.61 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000436074 (ChrX:53850962..53851096 -)
Downstram Exon
ENSMUSE00000364351 (ChrX:53848567..53848619 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTGTAGGTGTCGGGCTTTTT ChrX:53850996..53851015 59.61 45 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000436074 ChrX:53850962..53851096 TTGTAGGTGTCGGGCTTTTT ChrX:53850996..53851015 59.61 45

*** Putative Vector Insertion (Chr X: 53848620 - 53850961) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000364351 ChrX:53848567..53848619 No primer for this exon
downstream ENSMUSE00000412050 ChrX:53844255..53844358 GAACTCCCCTGCGATATGAA ChrX:53844268..53844287 60.04 50
downstream ENSMUSE00000366591 ChrX:53838689..53842480 ATTGTGCATACTTGCCACCA ChrX:53838874..53838893 59.99 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGCGCAGCGTAAGTAACTG ChrX:53850949..53850969 59.84 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGCGCAGCGTAAGTAACTG ChrX:53850949..53850969 59.84 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000061273