Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI3756
Trapped Gene
Pggt1b (ENSMUSG00000024477)
Vector Insertion
Chr 18: 46422612 - 46434243
Public Clones XR1181 (sanger) IST13894C5 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 23% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000142722 (Chr18:46434244..46434362 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCCTTGGATGTGGTGAACAA Chr18:46434297..46434316 59.94 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000142722 (Chr18:46434244..46434362 -)
Downstram Exon
ENSMUSE00000142709 (Chr18:46422544..46422611 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCCTTGGATGTGGTGAACAA Chr18:46434297..46434316 59.94 45 TGAAGAACCTCGGAAACCAC Chr18:46422552..46422571 60.09 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000367844 Chr18:46440334..46440504 AAGGAGAACGGCTGGATTTC Chr18:46440414..46440433 60.58 50
upstream ENSMUSE00000142722 Chr18:46434244..46434362 TCCTTGGATGTGGTGAACAA Chr18:46434297..46434316 59.94 45

*** Putative Vector Insertion (Chr 18: 46422612 - 46434243) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000142709 Chr18:46422544..46422611 TGAAGAACCTCGGAAACCAC Chr18:46422552..46422571 60.09 50
downstream ENSMUSE00000142723 Chr18:46419258..46419409 CCACACGGCCTAAGTCATCT Chr18:46419288..46419307 60.13 55
downstream ENSMUSE00000142718 Chr18:46417739..46417871 CCGACCAGTTGTTGAGCATA Chr18:46417761..46417780 59.72 50
downstream ENSMUSE00000142720 Chr18:46413933..46413978 ATGAGACTCAAGGCCTGCTC Chr18:46413912..46413931 59.56 55
downstream ENSMUSE00000142716 Chr18:46408525..46408709 TTACCCATCAGGCACAGTGA Chr18:46408642..46408661 60.11 50
downstream ENSMUSE00000142710 Chr18:46406216..46406324 CCAACAAGGCGATCTTGAGT Chr18:46406226..46406245 60.26 50
downstream ENSMUSE00000379175 Chr18:46399603..46401355 TTCCAATTGTGTCACGCTGT Chr18:46399943..46399962 60.16 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATTGGCTAATCGCCTTGC Chr18:46434180..46434200 60.19 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACCCACCTGAATCCTCACAT Chr18:46425203..46425223 59.23 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TATCTAATCGCCTTGCAGCAC Chr18:46428295..46428316 60.38 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 ACTCTCTGGGCTGGATATGCT Chr18:46425319..46425340 60.25 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024477