Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI37564
Trapped Gene
Pkig (ENSMUSG00000035268)
Vector Insertion
Chr 2: 163484229 - 163484885
Public Clones (egtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000427413 (Chr2:163484135..163484228 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000427413 (Chr2:163484135..163484228 +)
Downstram Exon
ENSMUSE00000639333 (Chr2:163484886..163484971 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TACAACAGCCTCCACTGCAT Chr2:163484916..163484935 59.32 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000427413 Chr2:163484135..163484228 No primer for this exon
upstream ENSMUSE00000639334 Chr2:163484187..163484228 No primer for this exon

*** Putative Vector Insertion (Chr 2: 163484229 - 163484885) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000639333 Chr2:163484886..163484971 TACAACAGCCTCCACTGCAT Chr2:163484916..163484935 59.32 50
downstream ENSMUSE00000680142 Chr2:163519773..163519892 TCCTAGGTCAGATGGGAAGG Chr2:163519869..163519888 59.09 55
downstream ENSMUSE00000328300 Chr2:163529222..163529291 GCCTGCATCTCTTCAGGTTT Chr2:163529273..163529292 59.43 50
downstream ENSMUSE00000328292 Chr2:163546864..163547037 TCCGAGTAGGAGGACTCGAC Chr2:163546918..163546937 59.4 60
downstream ENSMUSE00000427401 Chr2:163551193..163551886 CACAGGCAGACTCAGGATGA Chr2:163551286..163551305 59.98 55
downstream ENSMUSE00000639332 Chr2:163551193..163551894 CACAGGCAGACTCAGGATGA Chr2:163551286..163551305 59.98 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTAGAGCGGGTGAACGTGAC Chr2:163484240..163484260 60.72 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTAGAGCGGGTGAACGTGAC Chr2:163484240..163484260 60.72 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000035268