Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI37565
Trapped Gene
Csnrp3 (ENSMUSG00000044647)
Vector Insertion
Chr 2: 65683851 - 65683942
Public Clones (egtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000691522 (Chr2:65683852..65683941 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTGCTGGAGCCCAAGTACAG Chr2:65683907..65683926 60.98 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000691522 (Chr2:65683852..65683941 +)
Downstram Exon
ENSMUSE00000644918 (Chr2:65683899..65683941 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTGCTGGAGCCCAAGTACAG Chr2:65683907..65683926 60.98 60 CTGTACTTGGGCTCCAGCAG Chr2:65683929..65683948 60.98 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC

*** Putative Vector Insertion (Chr 2: 65683851 - 65683942) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000691522 Chr2:65683852..65683941 CTGTACTTGGGCTCCAGCAG Chr2:65683929..65683948 60.98 60
downstream ENSMUSE00000644918 Chr2:65683899..65683941 CTGTACTTGGGCTCCAGCAG Chr2:65683929..65683948 60.98 60
downstream ENSMUSE00000691521 Chr2:65698588..65698749 TTCTTCCAACGTCCCCTTTA Chr2:65698638..65698657 59.54 45
downstream ENSMUSE00000708853 Chr2:65716022..65716109 AACTGCAGTATCCTCCGAAGAG Chr2:65716096..65716117 59.91 50
downstream ENSMUSE00000712818 Chr2:65716022..65716109 AACTGCAGTATCCTCCGAAGAG Chr2:65716096..65716117 59.91 50
downstream ENSMUSE00000720168 Chr2:65716022..65716109 AACTGCAGTATCCTCCGAAGAG Chr2:65716096..65716117 59.91 50
downstream ENSMUSE00000691509 Chr2:65787006..65787186 CTTTCGCTGCTGGAGACTTC Chr2:65787139..65787158 60.28 55
downstream ENSMUSE00000398116 Chr2:65787016..65787186 CTTTCGCTGCTGGAGACTTC Chr2:65787139..65787158 60.28 55
downstream ENSMUSE00000691516 Chr2:65787016..65787186 CTTTCGCTGCTGGAGACTTC Chr2:65787139..65787158 60.28 55
downstream ENSMUSE00000369291 Chr2:65840360..65840619 ACACGGTGACACAGCTGAAG Chr2:65840431..65840450 59.94 55
downstream ENSMUSE00000341477 Chr2:65857497..65857793 CAGTTCGTGCTTCTCGTCAA Chr2:65857697..65857716 60.17 50
downstream ENSMUSE00000353430 Chr2:65860028..65863663 GTACCGTGAAGGGGCACTAA Chr2:65861971..65861990 59.99 55
downstream ENSMUSE00000691508 Chr2:65860028..65861110 CAGAAACTGCTTCCGTCCTC Chr2:65860377..65860396 59.99 55
downstream ENSMUSE00000691514 Chr2:65860028..65861541 CAGAAACTGCTTCCGTCCTC Chr2:65860377..65860396 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGAGCTCTTCTCAGCGTGAC Chr2:65683888..65683908 59.45 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000044647