Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI37573
Trapped Gene
Lmod1 (ENSMUSG00000048096)
Vector Insertion
Chr 1: 137221848 - 137260246
Public Clones (cmhd) (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 15% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000385067 (Chr1:137221390..137221847 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTGAGTGAAGACCCCGACAT Chr1:137221617..137221636 59.97 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000385067 (Chr1:137221390..137221847 +)
Downstram Exon
ENSMUSE00000396118 (Chr1:137260247..137261746 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTGAGTGAAGACCCCGACAT Chr1:137221617..137221636 59.97 55 AGCTTGAGCAAGGTGGTGTT Chr1:137261322..137261341 59.91 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000385067 Chr1:137221390..137221847 GTGAGTGAAGACCCCGACAT Chr1:137221617..137221636 59.97 55

*** Putative Vector Insertion (Chr 1: 137221848 - 137260246) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000396118 Chr1:137260247..137261746 AGCTTGAGCAAGGTGGTGTT Chr1:137261322..137261341 59.91 50
downstream ENSMUSE00000361252 Chr1:137262659..137264642 CTTCCTTCGCCTGTAACTGC Chr1:137263797..137263816 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGATGGGTGTCCCTGCTAGA Chr1:137233853..137233873 59.68 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGAGGGGGCTCATAAGCAAAG Chr1:137224807..137224828 61.92 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000048096