Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI37574
Trapped Gene
Myo3b (ENSMUSG00000042064)
Vector Insertion
Chr 2: 70096150 - 70119209
Public Clones (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 67% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000644703 (Chr2:70096020..70096149 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCTGACGTGGTGGTAGTCCT Chr2:70096071..70096090 60.18 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000644703 (Chr2:70096020..70096149 +)
Downstram Exon
ENSMUSE00000644702 (Chr2:70119210..70119289 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCTGACGTGGTGGTAGTCCT Chr2:70096071..70096090 60.18 60 ATGTGGAGGCAAAGATCTCG Chr2:70119271..70119290 60.22 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000719085 Chr2:69877183..69877209 No primer for this exon
upstream ENSMUSE00000719673 Chr2:69877183..69877209 No primer for this exon
upstream ENSMUSE00000690882 Chr2:69877355..69877397 GGTGAGCACACAGGAGACAA Chr2:69877372..69877391 59.87 55
upstream ENSMUSE00000690922 Chr2:69877355..69877397 GGTGAGCACACAGGAGACAA Chr2:69877372..69877391 59.87 55
upstream ENSMUSE00000690881 Chr2:69921131..69921154 No primer for this exon
upstream ENSMUSE00000690920 Chr2:69933214..69933397 CAAAGGCACTTATGGCAAGG Chr2:69933313..69933332 60.63 50
upstream ENSMUSE00000714216 Chr2:69933214..69933397 CAAAGGCACTTATGGCAAGG Chr2:69933313..69933332 60.63 50
upstream ENSMUSE00000719224 Chr2:69933214..69933397 CAAAGGCACTTATGGCAAGG Chr2:69933313..69933332 60.63 50
upstream ENSMUSE00000721258 Chr2:69933214..69933397 CAAAGGCACTTATGGCAAGG Chr2:69933313..69933332 60.63 50
upstream ENSMUSE00000690876 Chr2:69934355..69934552 TGTGTGGGAGGACAGCTATG Chr2:69934520..69934539 59.7 55
upstream ENSMUSE00000644724 Chr2:69934418..69934552 TGTGTGGGAGGACAGCTATG Chr2:69934520..69934539 59.7 55
upstream ENSMUSE00000690873 Chr2:69934418..69934552 TGTGTGGGAGGACAGCTATG Chr2:69934520..69934539 59.7 55
upstream ENSMUSE00000644723 Chr2:69943434..69943538 GCTGGACGAAGCTGTGATTT Chr2:69943493..69943512 60.41 50
upstream ENSMUSE00000644721 Chr2:69943711..69943810 TCATCCACCGAGATGTGAAG Chr2:69943739..69943758 59.63 50
upstream ENSMUSE00000644720 Chr2:69946679..69946755 GCGGAGAAACACATCAGTTG Chr2:69946710..69946729 59.29 50
upstream ENSMUSE00000644719 Chr2:69964904..69965049 CTTGCGAGCAGCAGTATGAC Chr2:69964911..69964930 59.77 55
upstream ENSMUSE00000690872 Chr2:69965425..69965428 No primer for this exon
upstream ENSMUSE00000690875 Chr2:70020632..70021324 TTAGAATCAGCGTGGCACAG Chr2:70020742..70020761 60.01 50
upstream ENSMUSE00000644718 Chr2:70027600..70027665 CTGACAGCTGGTGTGAGGAA Chr2:70027626..70027645 60.02 55
upstream ENSMUSE00000644717 Chr2:70055072..70055227 TCTTGGACCACCCATTCATT Chr2:70055116..70055135 60.17 45
upstream ENSMUSE00000644716 Chr2:70070450..70070546 TGGAAGACCCCATCGAGTAG Chr2:70070468..70070487 60.06 55
upstream ENSMUSE00000644715 Chr2:70071553..70071669 AATTGCCTTAAACCCCTTCC Chr2:70071624..70071643 59.31 45
upstream ENSMUSE00000644713 Chr2:70072431..70072535 GGCTTTATCATGGGGTGAAA Chr2:70072438..70072457 59.76 45
upstream ENSMUSE00000644712 Chr2:70075874..70075957 AAAGCGCCCATCTGATTGTT Chr2:70075914..70075933 61.89 45
upstream ENSMUSE00000644711 Chr2:70076814..70077016 ACCCTACGCCAGAAAATCCT Chr2:70076826..70076845 59.96 50
upstream ENSMUSE00000644710 Chr2:70082904..70083002 TTCAGACTTCCCGAGGAAAA Chr2:70082974..70082993 59.78 45
upstream ENSMUSE00000644709 Chr2:70083351..70083465 GTTTGAGGCCATTCAGCACT Chr2:70083417..70083436 60.26 50
upstream ENSMUSE00000644708 Chr2:70089794..70089920 No primer for this exon
upstream ENSMUSE00000644707 Chr2:70091028..70091238 GAGGGGAGACCATTGTCAGA Chr2:70091097..70091116 60.05 55
upstream ENSMUSE00000644706 Chr2:70092450..70092597 ATGTGGGCATCTTGGACATT Chr2:70092470..70092489 60.2 45
upstream ENSMUSE00000644705 Chr2:70093304..70093457 ATGAAGACAATCGCCCACTC Chr2:70093347..70093366 60.08 50
upstream ENSMUSE00000644704 Chr2:70094546..70094634 CCCAAAGGTGTGGAACTCTG Chr2:70094587..70094606 60.54 55
upstream ENSMUSE00000644703 Chr2:70096020..70096149 GCTGACGTGGTGGTAGTCCT Chr2:70096071..70096090 60.18 60

*** Putative Vector Insertion (Chr 2: 70096150 - 70119209) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000644702 Chr2:70119210..70119289 ATGTGGAGGCAAAGATCTCG Chr2:70119271..70119290 60.22 50
downstream ENSMUSE00000644701 Chr2:70124976..70125053 GGATGTCGAATCACCTCCAG Chr2:70125007..70125026 60.47 55
downstream ENSMUSE00000644700 Chr2:70127427..70127632 GAAGATGCGATGGGAGTAGC Chr2:70127615..70127634 59.8 55
downstream ENSMUSE00000352136 Chr2:70151361..70151472 TGCTCGGAATGCCAAGTAAT Chr2:70151388..70151407 60.61 45
downstream ENSMUSE00000360990 Chr2:70152333..70152495 ACCACTCGTCCCATGACTTC Chr2:70152403..70152422 59.97 55
downstream ENSMUSE00000381097 Chr2:70153407..70153487 GTGAATGTGAGCCTCGGACT Chr2:70153486..70153505 60.27 55
downstream ENSMUSE00000343710 Chr2:70168889..70168997 GGCAGTTCCTTGACGTCTCT Chr2:70168978..70168997 59.46 55
downstream ENSMUSE00000354896 Chr2:70186944..70187028 TCTGCATGTCCTGAGGTGAC Chr2:70187003..70187022 59.83 55
downstream ENSMUSE00000350553 Chr2:70187956..70188052 GAGTCTTCACAGGGGCTCAG Chr2:70188044..70188063 59.99 60
downstream ENSMUSE00000390896 Chr2:70263630..70263736 TCTGGGAGAGACCTTCTTCG Chr2:70263656..70263675 59.53 55
downstream ENSMUSE00000644693 Chr2:70263631..70263736 ACTCAACATTTTGGGCTGCT Chr2:70263703..70263722 59.74 45
downstream ENSMUSE00000342305 Chr2:70264111..70264157 TTCCTCTGGCTCCCTTGATA Chr2:70264145..70264164 59.77 50
downstream ENSMUSE00000411321 Chr2:70264880..70266290 CTCTGGGTGACGAGGAGAAG Chr2:70264998..70265017 59.98 60
downstream ENSMUSE00000644691 Chr2:70264880..70267255 CTCTGGGTGACGAGGAGAAG Chr2:70264998..70265017 59.98 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACCTGAGAACTCCCCAAAGC Chr2:70096153..70096173 60.63 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACCTGAGAACTCCCCAAAGC Chr2:70096153..70096173 60.63 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000042064