Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI37587
Trapped Gene
Rab11fip4 (ENSMUSG00000017639)
Vector Insertion
Chr 11: 79404937 - 79433130
Public Clones (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 8% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000405301 (Chr11:79404518..79404936 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000405301 (Chr11:79404518..79404936 +)
Downstram Exon
ENSMUSE00000108441 (Chr11:79433131..79433218 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000405301 Chr11:79404518..79404936 No primer for this exon

*** Putative Vector Insertion (Chr 11: 79404937 - 79433130) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000108441 Chr11:79433131..79433218 No primer for this exon
downstream ENSMUSE00000108452 Chr11:79433969..79434057 No primer for this exon
downstream ENSMUSE00000578189 Chr11:79474329..79474358 No primer for this exon
downstream ENSMUSE00000108453 Chr11:79494290..79494513 No primer for this exon
downstream ENSMUSE00000711083 Chr11:79496843..79497037 No primer for this exon
downstream ENSMUSE00000712624 Chr11:79496843..79497037 No primer for this exon
downstream ENSMUSE00000587041 Chr11:79497725..79497859 No primer for this exon
downstream ENSMUSE00000676062 Chr11:79497725..79497859 No primer for this exon
downstream ENSMUSE00000587040 Chr11:79498103..79498138 No primer for this exon
downstream ENSMUSE00000676061 Chr11:79498103..79498138 No primer for this exon
downstream ENSMUSE00000587039 Chr11:79498530..79498629 No primer for this exon
downstream ENSMUSE00000676060 Chr11:79498530..79498629 No primer for this exon
downstream ENSMUSE00000587038 Chr11:79498888..79498991 No primer for this exon
downstream ENSMUSE00000676059 Chr11:79498888..79498991 No primer for this exon
downstream ENSMUSE00000108495 Chr11:79500054..79500194 No primer for this exon
downstream ENSMUSE00000587037 Chr11:79500054..79500194 No primer for this exon
downstream ENSMUSE00000108440 Chr11:79503117..79503198 No primer for this exon
downstream ENSMUSE00000587036 Chr11:79503117..79503198 No primer for this exon
downstream ENSMUSE00000108494 Chr11:79503960..79504097 No primer for this exon
downstream ENSMUSE00000587035 Chr11:79503960..79504097 No primer for this exon
downstream ENSMUSE00000108493 Chr11:79504174..79504329 No primer for this exon
downstream ENSMUSE00000587034 Chr11:79504174..79504329 No primer for this exon
downstream ENSMUSE00000108446 Chr11:79505258..79505401 No primer for this exon
downstream ENSMUSE00000587033 Chr11:79505258..79505401 No primer for this exon
downstream ENSMUSE00000349652 Chr11:79506225..79511524 No primer for this exon
downstream ENSMUSE00000587032 Chr11:79506225..79507514 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAGCAAGGCCTGGAACTTAT Chr11:79431930..79431950 58.41 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGCAAGGCCTGGAACTTAT Chr11:79431930..79431950 58.41 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000017639