Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI37593
Trapped Gene
Phka1 (ENSMUSG00000034055)
Vector Insertion
Chr X: 99770303 - 99781551
Public Clones (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 40% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000284759 (ChrX:99781416..99781550 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGCCAGCTCGTATTCTCAGC ChrX:99781435..99781454 59.75 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000284759 (ChrX:99781416..99781550 -)
Downstram Exon
ENSMUSE00000284753 (ChrX:99770304..99770413 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGCCAGCTCGTATTCTCAGC ChrX:99781435..99781454 59.75 55 AGGGTCGTCCACTGAGTTTC ChrX:99770356..99770375 59.15 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000504817 ChrX:99839186..99839523 GAGCAAGGGAGCGTTTAGAA ChrX:99839328..99839347 59.59 50
upstream ENSMUSE00000718148 ChrX:99839186..99839585 GAGCAAGGGAGCGTTTAGAA ChrX:99839328..99839347 59.59 50
upstream ENSMUSE00000284856 ChrX:99837560..99837718 GCATATCGCAAAAATGCTGA ChrX:99837600..99837619 59.81 40
upstream ENSMUSE00000284849 ChrX:99834420..99834467 TAATGAGGGGACTGCTGCAC ChrX:99834435..99834454 61.21 55
upstream ENSMUSE00000284841 ChrX:99831882..99832050 CACCAAAACTTGTGCCACTG ChrX:99831966..99831985 60.19 50
upstream ENSMUSE00000284831 ChrX:99820927..99821009 CCACAGCCTAGACGAAGTCA ChrX:99820977..99820996 59.03 55
upstream ENSMUSE00000284821 ChrX:99816677..99816757 ACGTGGCGATAAGACAAACC ChrX:99816721..99816740 60 50
upstream ENSMUSE00000284809 ChrX:99812656..99812754 GGTGGGCCACAATCAGTTAT ChrX:99812690..99812709 59.68 50
upstream ENSMUSE00000284803 ChrX:99811250..99811396 AGGGCTTCAACATCCAAAGA ChrX:99811353..99811372 59.67 45
upstream ENSMUSE00000284795 ChrX:99805491..99805544 CTGTCGTTTTCTGCGAGATG ChrX:99805511..99805530 59.59 50
upstream ENSMUSE00000284788 ChrX:99804381..99804503 TCCTTGATGGGATCTTCAGTG ChrX:99804395..99804415 60.06 47.62
upstream ENSMUSE00000284781 ChrX:99793525..99793620 GTCCTCATCAAGGGCAAAAA ChrX:99793571..99793590 60.05 45
upstream ENSMUSE00000284774 ChrX:99792741..99792848 TCACATGTGGGGTCAGTCTC ChrX:99792770..99792789 59.5 55
upstream ENSMUSE00000284765 ChrX:99787966..99788044 TTGATCCCCTGAATCGTAGG ChrX:99788003..99788022 59.89 50
upstream ENSMUSE00000284759 ChrX:99781416..99781550 AGCCAGCTCGTATTCTCAGC ChrX:99781435..99781454 59.75 55
upstream ENSMUSE00000284753 ChrX:99770304..99770413 ATGGGTGTGCTTGGAACATC ChrX:99770350..99770369 60.79 50

*** Putative Vector Insertion (Chr X: 99770303 - 99781551) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000284744 ChrX:99768807..99768951 GGTGTGCGAGATAGGGAAAG ChrX:99768792..99768811 59.69 55
downstream ENSMUSE00000284736 ChrX:99764629..99764707 CATCCTGCATTTTTCGGAGT ChrX:99764626..99764645 60.07 45
downstream ENSMUSE00000284728 ChrX:99754904..99755073 CCAGTTGCCAGAGTCCAAAT ChrX:99754910..99754929 60.11 50
downstream ENSMUSE00000284720 ChrX:99752435..99752611 GTCGCAAGTTGTTTGCACAG ChrX:99752456..99752475 60.49 50
downstream ENSMUSE00000284711 ChrX:99750865..99750956 GTGAAGGACGAGAAGGCTGA ChrX:99750884..99750903 60.53 55
downstream ENSMUSE00000284704 ChrX:99750223..99750362 TGGTCCCTAGGAAGATGCAC ChrX:99750300..99750319 60.07 55
downstream ENSMUSE00000284693 ChrX:99740647..99740803 GTGCCGAATTTCACCAACTT ChrX:99740685..99740704 59.98 45
downstream ENSMUSE00000284687 ChrX:99740013..99740092 TCTCGAGGTTCTGGAGGAAG ChrX:99740006..99740025 59.53 55
downstream ENSMUSE00000284678 ChrX:99736711..99736789 ATGCTCATGTCGCCTTCACT ChrX:99736705..99736724 60.83 50
downstream ENSMUSE00000284669 ChrX:99736451..99736580 AACCGATTCGAAGTCTGAACA ChrX:99736480..99736500 59.73 42.86
downstream ENSMUSE00000284660 ChrX:99732523..99732624 TGAGATTCATCAGGCCCTCT ChrX:99732570..99732589 59.76 50
downstream ENSMUSE00000284652 ChrX:99727742..99727857 GCATGATTCCAGTTCGTTCA ChrX:99727743..99727762 59.65 45
downstream ENSMUSE00000284645 ChrX:99727416..99727454 CGAGACAGACAGCCTACGAA ChrX:99727406..99727425 59.19 55
downstream ENSMUSE00000710304 ChrX:99727261..99727299 No primer for this exon
downstream ENSMUSE00000284640 ChrX:99723406..99723456 AATCTACACCCGAGGGATGA ChrX:99723404..99723423 59.36 50
downstream ENSMUSE00000284634 ChrX:99716093..99716263 CCACTGGCCTTGACGACTAT ChrX:99716152..99716171 60.13 55
downstream ENSMUSE00000284626 ChrX:99712782..99712835 No primer for this exon
downstream ENSMUSE00000284624 ChrX:99712116..99712316 CAACCAGAAGTTGGCGGTAT ChrX:99712207..99712226 59.99 50
downstream ENSMUSE00000505810 ChrX:99710704..99711554 CCATGCACAATCAACCAGAC ChrX:99711296..99711315 59.97 50
downstream ENSMUSE00000709199 ChrX:99709314..99711554 CCACAGGCAAATCCGTAACT ChrX:99709453..99709472 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCAAGGCCATTTTGAAGGAC ChrX:99778502..99778522 60.05 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCAAGGCCATTTTGAAGGAC ChrX:99778502..99778522 60.05 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000034055