Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI37617
Trapped Gene
Nsun2 (ENSMUSG00000021595)
Vector Insertion
Chr 13: 69754396 - 69756283
Public Clones (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 13% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000391774 (Chr13:69754290..69754395 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000391774 (Chr13:69754290..69754395 +)
Downstram Exon
ENSMUSE00000119296 (Chr13:69756284..69756355 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000641272 Chr13:69750941..69751066 No primer for this exon
upstream ENSMUSE00000681252 Chr13:69751122..69751336 No primer for this exon
upstream ENSMUSE00000384059 Chr13:69751179..69751336 No primer for this exon
upstream ENSMUSE00000342982 Chr13:69751816..69751920 No primer for this exon
upstream ENSMUSE00000391774 Chr13:69754290..69754395 No primer for this exon

*** Putative Vector Insertion (Chr 13: 69754396 - 69756283) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000119296 Chr13:69756284..69756355 No primer for this exon
downstream ENSMUSE00000119309 Chr13:69756984..69757068 No primer for this exon
downstream ENSMUSE00000119288 Chr13:69758324..69758516 No primer for this exon
downstream ENSMUSE00000119299 Chr13:69760483..69760557 No primer for this exon
downstream ENSMUSE00000119287 Chr13:69762041..69762171 No primer for this exon
downstream ENSMUSE00000119290 Chr13:69765356..69765429 No primer for this exon
downstream ENSMUSE00000119305 Chr13:69765914..69766044 No primer for this exon
downstream ENSMUSE00000119297 Chr13:69766438..69766534 No primer for this exon
downstream ENSMUSE00000230251 Chr13:69768413..69768594 No primer for this exon
downstream ENSMUSE00000119298 Chr13:69768880..69768972 No primer for this exon
downstream ENSMUSE00000119307 Chr13:69769506..69769641 No primer for this exon
downstream ENSMUSE00000119301 Chr13:69770113..69770193 No primer for this exon
downstream ENSMUSE00000119294 Chr13:69770410..69770548 No primer for this exon
downstream ENSMUSE00000119300 Chr13:69772106..69772145 No primer for this exon
downstream ENSMUSE00000432018 Chr13:69772450..69774535 No primer for this exon
downstream ENSMUSE00000706162 Chr13:69772450..69773211 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGCTGTGATTAATCGCCTTG Chr13:69754438..69754458 59.83 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000021595