Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI37619
Trapped Gene
Wnt10b (ENSMUSG00000022996)
Vector Insertion
Chr 15: 98604817 - 98605328
Public Clones (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 12% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000679151 (Chr15:98605324..98605327 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000679151 (Chr15:98605324..98605327 -)
Downstram Exon
ENSMUSE00000473857 (Chr15:98604818..98604941 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon AGCACTCTCACGGAAACCTG Chr15:98604890..98604909 60.44 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000485109 Chr15:98608289..98608581 CAGTTTCCCCACGGTTTAAG Chr15:98608355..98608374 59.47 50
upstream ENSMUSE00000621168 Chr15:98607321..98607432 TTCTTGGCTTTGTTCAGTCG Chr15:98607321..98607340 59.05 45
upstream ENSMUSE00000679153 Chr15:98607003..98607063 GTTCACGAGTGTCAGCACCA Chr15:98607029..98607048 60.95 55
upstream ENSMUSE00000268982 Chr15:98606949..98607211 CCTGTCCGGACTGAGTAAGC Chr15:98607117..98607136 59.87 60
upstream ENSMUSE00000679152 Chr15:98606389..98606419 AGGTGTCCCTCACCTGAACA Chr15:98606390..98606409 60.56 55
upstream ENSMUSE00000679151 Chr15:98605324..98605327 No primer for this exon
upstream ENSMUSE00000473857 Chr15:98604818..98604941 CAGGTTTCCGTGAGAGTGCT Chr15:98604912..98604931 60.44 55

*** Putative Vector Insertion (Chr 15: 98604817 - 98605328) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000132546 Chr15:98604555..98604928 TCCAAGAAATCCCGAGAGAA Chr15:98604600..98604619 59.74 45
downstream ENSMUSE00000551321 Chr15:98604555..98604712 TCCAAGAAATCCCGAGAGAA Chr15:98604600..98604619 59.74 45
downstream ENSMUSE00000551320 Chr15:98602193..98603365 CACTTCCGCTTCAGGTTTTC Chr15:98603315..98603334 59.85 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATTTAATCGCCTTGCAGCAC Chr15:98605260..98605280 60.24 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GATTCGTGACTGGGAAAACC Chr15:98605261..98605281 59.39 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022996