Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI37639
Trapped Gene
Birc2 (ENSMUSG00000057367)
Vector Insertion
Chr 9: 7820973 - 7825664
Public Clones (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 60% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000638660 (Chr9:7825615..7825663 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAGACACCCCAGGAGAAGAA Chr9:7825631..7825650 60.23 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000638660 (Chr9:7825615..7825663 -)
Downstram Exon
ENSMUSE00000638659 (Chr9:7820974..7821219 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAGACACCCCAGGAGAAGAA Chr9:7825631..7825650 60.23 55 TGAACCGTCTGTCTCACCAG Chr9:7821077..7821096 59.86 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000496310 Chr9:7833505..7835269 AGAACACGCCAAATGGTTTC Chr9:7833509..7833528 59.98 45
upstream ENSMUSE00000360989 Chr9:7826931..7827009 GATACGGATGAAGGGTCAGG Chr9:7826978..7826997 59.36 55
upstream ENSMUSE00000638660 Chr9:7825615..7825663 CAGACACCCCAGGAGAAGAA Chr9:7825631..7825650 60.23 55
upstream ENSMUSE00000638659 Chr9:7820974..7821219 TGGTGAGACAGACGGTTCAG Chr9:7821098..7821117 59.86 55

*** Putative Vector Insertion (Chr 9: 7820973 - 7825664) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000638658 Chr9:7819307..7819561 CTGTTGAAAGAGGGCCATTC Chr9:7819493..7819512 59.67 50
downstream ENSMUSE00000638657 Chr9:7819021..7819062 CTGAAACGTCTTCTGTTGGAAT Chr9:7818999..7819020 58.37 40.91
downstream ENSMUSE00000585131 Chr9:7818236..7818943 TCCACATCACCTGAATCCAA Chr9:7818438..7818457 59.89 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCCAGGAGAAGAAAATGCTG Chr9:7825622..7825642 59.81 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCCAGGAGAAGAAAATGCTG Chr9:7825622..7825642 59.81 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000057367