Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI37645
Trapped Gene
Actr3b (ENSMUSG00000056367)
Vector Insertion
Chr 5: 25265947 - 25304263
Public Clones (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 4% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000477407 (Chr5:25265817..25265946 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000477407 (Chr5:25265817..25265946 +)
Downstram Exon
ENSMUSE00000551024 (Chr5:25304264..25304319 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TGACGGGATAATGAACTGTGG Chr5:25304320..25304340 60.76 47.62

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000477407 Chr5:25265817..25265946 No primer for this exon
upstream ENSMUSE00000602126 Chr5:25265844..25265946 No primer for this exon

*** Putative Vector Insertion (Chr 5: 25265947 - 25304263) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000551024 Chr5:25304264..25304319 TGACGGGATAATGAACTGTGG Chr5:25304320..25304340 60.76 47.62
downstream ENSMUSE00000655217 Chr5:25315603..25315727 CAATGGCTTCATCCCCTATG Chr5:25315707..25315726 60.29 50
downstream ENSMUSE00000655215 Chr5:25317735..25317845 ATCCCAGTCTTCAACGATGC Chr5:25317773..25317792 60.08 50
downstream ENSMUSE00000655214 Chr5:25328223..25328318 CTGGTGTGTTCAGTGGAGGTT Chr5:25328249..25328269 60.06 52.38
downstream ENSMUSE00000655213 Chr5:25330926..25331033 TGACACCGTCTCCACTGTCT Chr5:25331019..25331038 59.28 55
downstream ENSMUSE00000655210 Chr5:25335344..25335487 CTGCAATTGGGATGTGTTTG Chr5:25335395..25335414 59.96 45
downstream ENSMUSE00000655208 Chr5:25337429..25337602 CTGACAATATCCGGGCAAAT Chr5:25337466..25337485 59.78 45
downstream ENSMUSE00000655207 Chr5:25338204..25338296 TTCATCGACAACATCCGAGA Chr5:25338254..25338273 60.2 45
downstream ENSMUSE00000655206 Chr5:25354180..25354305 GCAGACGACGTCCAAAATCT Chr5:25354237..25354256 60.26 50
downstream ENSMUSE00000655205 Chr5:25354891..25354974 CTAGCATCGAGCCTCCAAAC Chr5:25354969..25354988 59.98 55
downstream ENSMUSE00000551022 Chr5:25355669..25356155 GGACGCCTTCAGAGCTACAC Chr5:25356042..25356061 60.02 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGCTCCACACCTGCCTAGAA Chr5:25280908..25280928 60.01 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTTATCGTGACTGGGAAAACC Chr5:25265993..25266014 58.42 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000056367