Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI37658
Trapped Gene
Zfp386 (ENSMUSG00000042063)
Vector Insertion
Chr 12: 117286078 - 117293180
Public Clones (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000516642 (Chr12:117285930..117286077 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AATATCGCGAGTCCACATCC Chr12:117285948..117285967 59.92 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000516642 (Chr12:117285930..117286077 +)
Downstram Exon
ENSMUSE00000570419 (Chr12:117293181..117293316 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AATATCGCGAGTCCACATCC Chr12:117285948..117285967 59.92 50 CATCCGGAGAGAAGTCAACG Chr12:117293238..117293257 60.79 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000516642 Chr12:117285930..117286077 AATATCGCGAGTCCACATCC Chr12:117285948..117285967 59.92 50
upstream ENSMUSE00000681270 Chr12:117285935..117286077 AATATCGCGAGTCCACATCC Chr12:117285948..117285967 59.92 50

*** Putative Vector Insertion (Chr 12: 117286078 - 117293180) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000570419 Chr12:117293181..117293316 CATCCGGAGAGAAGTCAACG Chr12:117293238..117293257 60.79 55
downstream ENSMUSE00000267221 Chr12:117293190..117293421 AGGAAAGGCATGAAATGGTG Chr12:117293377..117293396 59.93 45
downstream ENSMUSE00000511282 Chr12:117297373..117297728 TTCAGGATCTGCTCTGGTGA Chr12:117297424..117297443 59.5 50
downstream ENSMUSE00000532900 Chr12:117297373..117299060 GTTGGGACTCAAGCAATGGT Chr12:117298082..117298101 59.97 50
downstream ENSMUSE00000360231 Chr12:117297731..117297763 No primer for this exon
downstream ENSMUSE00000509483 Chr12:117297766..117297867 TGGCTCTTCCAGGATAGGAA Chr12:117297822..117297841 59.77 50
downstream ENSMUSE00000651791 Chr12:117297870..117298191 GTTGGGACTCAAGCAATGGT Chr12:117298082..117298101 59.97 50
downstream ENSMUSE00000681268 Chr12:117298309..117298319 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr12:117292128..117292148 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTTATTGTTTCGCCTCGTGA Chr12:117292114..117292134 59.3 40 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000042063