Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI37667
Trapped Gene
Tgif1 (ENSMUSG00000047407)
Vector Insertion
Chr 17: 71200211 - 71201075
Public Clones (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000718089 (Chr17:71200650..71201074 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAGGATGGGGGTGTCTTTTC Chr17:71200894..71200913 60.17 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000718089 (Chr17:71200650..71201074 -)
Downstram Exon
ENSMUSE00000692627 (Chr17:71200212..71200550 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAGGATGGGGGTGTCTTTTC Chr17:71200894..71200913 60.17 50 TAAACAAGGTGCTCCGGTCT Chr17:71200347..71200366 59.73 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000710962 Chr17:71202788..71202886 CGCTCCGACTTCTTAACTGC Chr17:71202852..71202871 60.15 55
upstream ENSMUSE00000718089 Chr17:71200650..71201074 AAGGATGGGGGTGTCTTTTC Chr17:71200894..71200913 60.17 50
upstream ENSMUSE00000692627 Chr17:71200212..71200550 TCCTAGAAACCCCAGCTTCA Chr17:71200254..71200273 59.81 50

*** Putative Vector Insertion (Chr 17: 71200211 - 71201075) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000606362 Chr17:71195512..71195738 AGAGGCTGCTGATGAGGAAA Chr17:71195634..71195653 60.1 50
downstream ENSMUSE00000716636 Chr17:71195512..71195738 AGAGGCTGCTGATGAGGAAA Chr17:71195634..71195653 60.1 50
downstream ENSMUSE00000714388 Chr17:71193554..71194612 ATCCTGGTTGAGGTCTGGTG Chr17:71194096..71194115 59.96 55
downstream ENSMUSE00000606361 Chr17:71193552..71194612 ATCCTGGTTGAGGTCTGGTG Chr17:71194096..71194115 59.96 55
downstream ENSMUSE00000717035 Chr17:71193551..71194612 ATCCTGGTTGAGGTCTGGTG Chr17:71194096..71194115 59.96 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAATAATCGCCTTGCAGCAC Chr17:71201007..71201027 60.75 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGAACGTGACTGGGAAAACC Chr17:71201008..71201028 59.04 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000047407