Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI37669
Trapped Gene
Fbxl5 (ENSMUSG00000039753)
Vector Insertion
Chr 5: 44164682 - 44173355
Public Clones (sanger) (sanger) (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 5% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000707115 (Chr5:44173204..44173354 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCGAGGGTGTCTATGGAGAG Chr5:44173330..44173349 59.83 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000707115 (Chr5:44173204..44173354 -)
Downstram Exon
ENSMUSE00000289179 (Chr5:44164683..44164898 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCGAGGGTGTCTATGGAGAG Chr5:44173330..44173349 59.83 60 ACTGGAGAAGAGCACGGAAG Chr5:44164825..44164844 59.6 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000697948 Chr5:44212780..44212845 CACCTTGACTGCAGTGTCGT Chr5:44212784..44212803 59.94 55
upstream ENSMUSE00000707115 Chr5:44173204..44173354 GCGAGGGTGTCTATGGAGAG Chr5:44173330..44173349 59.83 60
upstream ENSMUSE00000720848 Chr5:44173204..44173357 GCGAGGGTGTCTATGGAGAG Chr5:44173330..44173349 59.83 60
upstream ENSMUSE00000721243 Chr5:44173204..44173376 GCGAGGGTGTCTATGGAGAG Chr5:44173330..44173349 59.83 60
upstream ENSMUSE00000289179 Chr5:44164683..44164898 GCTCTCCGAGATGCTGAGTC Chr5:44164712..44164731 60.26 60
upstream ENSMUSE00000710518 Chr5:44164683..44164847 GCTCTCCGAGATGCTGAGTC Chr5:44164712..44164731 60.26 60
upstream ENSMUSE00000721204 Chr5:44164683..44164769 GCTCTCCGAGATGCTGAGTC Chr5:44164712..44164731 60.26 60

*** Putative Vector Insertion (Chr 5: 44164682 - 44173355) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000289169 Chr5:44161976..44162071 No primer for this exon
downstream ENSMUSE00000289158 Chr5:44159303..44159489 ACTTTCTGTCGCTCCTCAGC Chr5:44159316..44159335 59.75 55
downstream ENSMUSE00000289151 Chr5:44156548..44156730 TTGCCAGCTGAGACCACTTA Chr5:44156574..44156593 59.59 50
downstream ENSMUSE00000289144 Chr5:44154056..44154181 CTTCATCCCACTCCTGGAAA Chr5:44154055..44154074 60.04 50
downstream ENSMUSE00000289137 Chr5:44151946..44152094 TCCATTTGTGCAATGCTGAT Chr5:44152027..44152046 60.08 40
downstream ENSMUSE00000289129 Chr5:44150982..44151064 CAGAAATGTCGGTCTGGGTAA Chr5:44150976..44150996 59.98 47.62
downstream ENSMUSE00000289122 Chr5:44149461..44150183 CAACCAAAGTTGGAGGCTGT Chr5:44149745..44149764 60.15 50
downstream ENSMUSE00000545857 Chr5:44149436..44150183 CAACCAAAGTTGGAGGCTGT Chr5:44149745..44149764 60.15 50
downstream ENSMUSE00000718269 Chr5:44149125..44150183 CAACCAAAGTTGGAGGCTGT Chr5:44149745..44149764 60.15 50
downstream ENSMUSE00000289115 Chr5:44142101..44142249 AGGACACGCTGAGACCAAAT Chr5:44142122..44142141 59.73 50
downstream ENSMUSE00000354426 Chr5:44135857..44136614 GCCCCTCAGAATTGTTCAAA Chr5:44136034..44136053 60.05 45
downstream ENSMUSE00000713052 Chr5:44135855..44136614 GCCCCTCAGAATTGTTCAAA Chr5:44136034..44136053 60.05 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTATAATCGCCTTGCAGCAC Chr5:44170287..44170307 58.56 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCGAGGGTGTCTATGGAGAG Chr5:44170328..44170348 59.83 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000039753