Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI37681
Trapped Gene
Zfp462 (ENSMUSG00000060206)
Vector Insertion
Chr 4: 55020655 - 55024237
Public Clones (ggtc) (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000487524 (Chr4:55020405..55020654 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCCACACGGCATTCTTACAG Chr4:55020511..55020530 59.72 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000487524 (Chr4:55020405..55020654 +)
Downstram Exon
ENSMUSE00000527230 (Chr4:55024238..55026721 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCCACACGGCATTCTTACAG Chr4:55020511..55020530 59.72 50 GATCACCTTGTTGGGCTTGT Chr4:55026109..55026128 59.97 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000673985 Chr4:54960817..54961104 CAATAACCCGAGCAGGAAGA Chr4:54961008..54961027 60.21 50
upstream ENSMUSE00000487524 Chr4:55020405..55020654 TCCACACGGCATTCTTACAG Chr4:55020511..55020530 59.72 50

*** Putative Vector Insertion (Chr 4: 55020655 - 55024237) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000632627 Chr4:55021128..55026721 GCAAGTTGTCGCAGAATGAA Chr4:55022777..55022796 59.99 45
downstream ENSMUSE00000527230 Chr4:55024238..55026721 GATCACCTTGTTGGGCTTGT Chr4:55026109..55026128 59.97 50
downstream ENSMUSE00000632619 Chr4:55024352..55026721 GATCACCTTGTTGGGCTTGT Chr4:55026109..55026128 59.97 50
downstream ENSMUSE00000527229 Chr4:55027555..55027719 TCCTTGATCTTTGGCACCTC Chr4:55027595..55027614 60.19 50
downstream ENSMUSE00000673956 Chr4:55029686..55029972 ACATTGCATCAAGCAAGCAG Chr4:55029803..55029822 60.02 45
downstream ENSMUSE00000673961 Chr4:55029689..55029972 ACATTGCATCAAGCAAGCAG Chr4:55029803..55029822 60.02 45
downstream ENSMUSE00000527228 Chr4:55029869..55029972 TGGCAGCTGTACTTGTCCTC Chr4:55029942..55029961 59.04 55
downstream ENSMUSE00000360129 Chr4:55032961..55033079 CGGCTGTTGTAGGAGGACTT Chr4:55033050..55033069 59.35 55
downstream ENSMUSE00000179018 Chr4:55036287..55036478 CATGGACCTTGAGGGAATGT Chr4:55036373..55036392 59.78 50
downstream ENSMUSE00000179012 Chr4:55063058..55063325 TAACGCGGCTCTTGTTTCTT Chr4:55063147..55063166 60.02 45
downstream ENSMUSE00000179016 Chr4:55064063..55064199 TGCAGCACTATGTGGTCGAT Chr4:55064197..55064216 60.3 50
downstream ENSMUSE00000179014 Chr4:55072886..55073109 AGTTTGGAACGGCACACTTC Chr4:55072928..55072947 60.16 50
downstream ENSMUSE00000179000 Chr4:55085845..55085977 GCTCATTTCGTCGTCCTTGT Chr4:55085961..55085980 60.26 50
downstream ENSMUSE00000179008 Chr4:55092136..55092259 CACGTGTCTTTCCCACTCAG Chr4:55092248..55092267 59.31 55
downstream ENSMUSE00000604453 Chr4:55093538..55096434 TAAACATGTGGCCAACGAAA Chr4:55094654..55094673 59.97 40
downstream ENSMUSE00000632620 Chr4:55093538..55094230 AGATCCGGAAGGAAGGATGT Chr4:55093992..55094011 59.9 50
downstream ENSMUSE00000673955 Chr4:55093538..55094202 AGATCCGGAAGGAAGGATGT Chr4:55093992..55094011 59.9 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTAGCCCGAATGTCAGAAGC Chr4:55023682..55023702 59.98 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTAGCCCGAATGTCAGAAGC Chr4:55023682..55023702 59.98 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000060206