Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI37682
Trapped Gene
Zfp442 (ENSMUSG00000068130)
Vector Insertion
Chr 2: 150236676 - 150237074
Public Clones (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 7% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000556832 (Chr2:150236947..150237073 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGGCTTTGCTGGATTCTTCT Chr2:150237005..150237024 60.71 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000556832 (Chr2:150236947..150237073 -)
Downstram Exon
ENSMUSE00000556831 (Chr2:150236677..150236737 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGGCTTTGCTGGATTCTTCT Chr2:150237005..150237024 60.71 50 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000682098 Chr2:150277138..150277222 TCTTCTTGGCGTGTTCTGTG Chr2:150277172..150277191 60.03 50
upstream ENSMUSE00000556832 Chr2:150236947..150237073 GGGCTTTGCTGGATTCTTCT Chr2:150237005..150237024 60.71 50
upstream ENSMUSE00000556831 Chr2:150236677..150236737 No primer for this exon

*** Putative Vector Insertion (Chr 2: 150236676 - 150237074) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000556830 Chr2:150233713..150235525 AATTTGTTGATGCCCCTGAG Chr2:150235407..150235426 59.93 45
downstream ENSMUSE00000682097 Chr2:150232877..150235525 AATTTGTTGATGCCCCTGAG Chr2:150235407..150235426 59.93 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr2:150237003..150237023 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000068130