Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI37686
Trapped Gene
OTTMUSG00000016578 (ENSMUSG00000078870)
Vector Insertion
Chr 2: 176987531 - 176991127
Public Clones (ggtc) (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000678634 (Chr2:176991045..176991126 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGTGATGTGTTCTGCGTGAC Chr2:176991096..176991115 59.27 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000678634 (Chr2:176991045..176991126 -)
Downstram Exon
ENSMUSE00000678637 (Chr2:176987532..176987586 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGTGATGTGTTCTGCGTGAC Chr2:176991096..176991115 59.27 50 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000678634 Chr2:176991045..176991126 TGTGATGTGTTCTGCGTGAC Chr2:176991096..176991115 59.27 50
upstream ENSMUSE00000678638 Chr2:176991045..176991207 CCTGCCAGTCAGAAGAGGAG Chr2:176991179..176991198 60.13 60
upstream ENSMUSE00000678637 Chr2:176987532..176987586 GCTGGATGCTGTGAATTTAGC Chr2:176987559..176987579 59.87 47.62
upstream ENSMUSE00000711800 Chr2:176987532..176987586 GCTGGATGCTGTGAATTTAGC Chr2:176987559..176987579 59.87 47.62

*** Putative Vector Insertion (Chr 2: 176987531 - 176991127) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000638713 Chr2:176980407..176980533 CACATGCACGTCATCATAGG Chr2:176980482..176980501 58.51 50
downstream ENSMUSE00000638712 Chr2:176980141..176980201 No primer for this exon
downstream ENSMUSE00000678633 Chr2:176979554..176980201 TGGAATGTCTTGCAAACAACA Chr2:176979936..176979956 60.14 38.1
downstream ENSMUSE00000678636 Chr2:176979159..176979160 No primer for this exon
downstream ENSMUSE00000678635 Chr2:176979034..176979047 No primer for this exon
downstream ENSMUSE00000570483 Chr2:176978062..176978983 GTGTTCGCTCATGTTTGTGG Chr2:176978276..176978295 60.16 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGTGAGTAATCGCCTTGCAG Chr2:176988062..176988082 60.01 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTTACCTGAACCCAGCCTGA Chr2:176988154..176988174 60.63 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000078870