Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI37688
Trapped Gene
6230416J20Rik (ENSMUSG00000038047)
Vector Insertion
Chr 4: 86251540 - 86253895
Public Clones (ggtc) (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 61% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000526147 (Chr4:86253799..86253894 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACTGAACCGTGATGCCTTTC Chr4:86253860..86253879 60.12 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000526147 (Chr4:86253799..86253894 -)
Downstram Exon
ENSMUSE00000717758 (Chr4:86251541..86251619 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACTGAACCGTGATGCCTTTC Chr4:86253860..86253879 60.12 50 CCGGAATTCCATGTCAAGTT Chr4:86251552..86251571 59.79 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000526148 Chr4:86257590..86257926 CGCTGCAGTCACTGTCTGTT Chr4:86257891..86257910 60.25 55
upstream ENSMUSE00000662697 Chr4:86257590..86257928 CGCTGCAGTCACTGTCTGTT Chr4:86257891..86257910 60.25 55
upstream ENSMUSE00000526147 Chr4:86253799..86253894 ACTGAACCGTGATGCCTTTC Chr4:86253860..86253879 60.12 50
upstream ENSMUSE00000710429 Chr4:86251541..86251619 ATGGAATTCCGGAAACATTG Chr4:86251566..86251585 59.62 40
upstream ENSMUSE00000717758 Chr4:86251541..86251619 ATGGAATTCCGGAAACATTG Chr4:86251566..86251585 59.62 40

*** Putative Vector Insertion (Chr 4: 86251540 - 86253895) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000526145 Chr4:86250061..86250193 TAAACTTAGGGCCACCAGGA Chr4:86250102..86250121 59.56 50
downstream ENSMUSE00000672296 Chr4:86250061..86250193 TAAACTTAGGGCCACCAGGA Chr4:86250102..86250121 59.56 50
downstream ENSMUSE00000526144 Chr4:86248723..86248867 GCAAGGCACTTGTGCATATCT Chr4:86248785..86248805 60.29 47.62
downstream ENSMUSE00000672295 Chr4:86248723..86248867 GCAAGGCACTTGTGCATATCT Chr4:86248785..86248805 60.29 47.62
downstream ENSMUSE00000314933 Chr4:86247132..86247192 No primer for this exon
downstream ENSMUSE00000662696 Chr4:86247127..86247192 No primer for this exon
downstream ENSMUSE00000662695 Chr4:86246655..86246703 No primer for this exon
downstream ENSMUSE00000513270 Chr4:86245163..86245333 ATTCACTGAAGCCCACAAGG Chr4:86245285..86245304 60.11 50
downstream ENSMUSE00000370871 Chr4:86241267..86241460 TTGGCCAGCCTTACAATGTT Chr4:86241328..86241347 60.5 45
downstream ENSMUSE00000315010 Chr4:86240645..86240771 CACTTTCCCTCCTTGTCAGC Chr4:86240687..86240706 59.84 55
downstream ENSMUSE00000315004 Chr4:86239496..86239598 GAGACATGGGAGGCAAAAGA Chr4:86239549..86239568 60.19 50
downstream ENSMUSE00000314995 Chr4:86234889..86234970 CACACTTCCTGGGGTATCCA Chr4:86234884..86234903 60.77 55
downstream ENSMUSE00000314989 Chr4:86232217..86232283 CGGCACACTGTAAGGGAAAA Chr4:86232233..86232252 61.05 50
downstream ENSMUSE00000314982 Chr4:86231667..86231849 TCTGGAATGGCTCACTCCTC Chr4:86231671..86231690 60.35 55
downstream ENSMUSE00000387141 Chr4:86231232..86231367 AGCTGTGGGGAATCAGACAG Chr4:86231311..86231330 60.26 55
downstream ENSMUSE00000314955 Chr4:86228785..86229777 GCGACCAACTTCTGGAAGAG Chr4:86229208..86229227 59.99 55
downstream ENSMUSE00000505229 Chr4:86227193..86227922 TGGCCATTAGGTTAGGCACT Chr4:86227517..86227536 59.59 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACTGAACCGTGATGCCTTTC Chr4:86253858..86253878 60.12 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACTGAACCGTGATGCCTTTC Chr4:86253858..86253878 60.12 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038047