Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI37693
Trapped Gene
Dot1l (ENSMUSG00000061589)
Vector Insertion
Chr 10: 80231414 - 80233882
Public Clones (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000665879 (Chr10:80231350..80231413 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAGCGGCTGTGTGACAAATA Chr10:80231363..80231382 60.87 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000665879 (Chr10:80231350..80231413 +)
Downstram Exon
ENSMUSE00000665878 (Chr10:80233883..80234111 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAGCGGCTGTGTGACAAATA Chr10:80231363..80231382 60.87 50 CCATACACCTCAGGGGAGAA Chr10:80234031..80234050 59.92 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000708659 Chr10:80217951..80218269 TCCTACAAAGAGGGGAGCTG Chr10:80218011..80218030 59.42 55
upstream ENSMUSE00000721433 Chr10:80217951..80218269 TCCTACAAAGAGGGGAGCTG Chr10:80218011..80218030 59.42 55
upstream ENSMUSE00000609647 Chr10:80227347..80227390 No primer for this exon
upstream ENSMUSE00000665881 Chr10:80227347..80227390 No primer for this exon
upstream ENSMUSE00000492244 Chr10:80228908..80228982 CCTGATCGACTACGACACCA Chr10:80228959..80228978 59.7 55
upstream ENSMUSE00000665880 Chr10:80228908..80228982 CCTGATCGACTACGACACCA Chr10:80228959..80228978 59.7 55
upstream ENSMUSE00000491314 Chr10:80231350..80231413 CAGCGGCTGTGTGACAAATA Chr10:80231363..80231382 60.87 50
upstream ENSMUSE00000665879 Chr10:80231350..80231413 CAGCGGCTGTGTGACAAATA Chr10:80231363..80231382 60.87 50

*** Putative Vector Insertion (Chr 10: 80231414 - 80233882) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000609646 Chr10:80233883..80234111 CCATACACCTCAGGGGAGAA Chr10:80234031..80234050 59.92 55
downstream ENSMUSE00000665878 Chr10:80233883..80234111 CCATACACCTCAGGGGAGAA Chr10:80234031..80234050 59.92 55
downstream ENSMUSE00000609645 Chr10:80235849..80235943 GATGTCCGCTTTCTCCACTC Chr10:80235928..80235947 59.81 55
downstream ENSMUSE00000665877 Chr10:80235849..80235943 GATGTCCGCTTTCTCCACTC Chr10:80235928..80235947 59.81 55
downstream ENSMUSE00000609644 Chr10:80236451..80236513 TTCCTGAACTCTCGGTCCAT Chr10:80236476..80236495 59.65 50
downstream ENSMUSE00000665876 Chr10:80236451..80236513 TTCCTGAACTCTCGGTCCAT Chr10:80236476..80236495 59.65 50
downstream ENSMUSE00000641647 Chr10:80239571..80239579 No primer for this exon
downstream ENSMUSE00000518173 Chr10:80240301..80240356 GAGGAAGTCACCTCGTTCCA Chr10:80240324..80240343 60.24 55
downstream ENSMUSE00000665874 Chr10:80240301..80240356 GAGGAAGTCACCTCGTTCCA Chr10:80240324..80240343 60.24 55
downstream ENSMUSE00000511049 Chr10:80241008..80241087 CTGGTGATCCACCTCAGGAC Chr10:80241059..80241078 60.53 60
downstream ENSMUSE00000665873 Chr10:80241008..80241087 CTGGTGATCCACCTCAGGAC Chr10:80241059..80241078 60.53 60
downstream ENSMUSE00000515960 Chr10:80243588..80243656 TCCTGCTGTTGATCCTGAAG Chr10:80243650..80243669 58.96 50
downstream ENSMUSE00000665872 Chr10:80243588..80243656 TCCTGCTGTTGATCCTGAAG Chr10:80243650..80243669 58.96 50
downstream ENSMUSE00000515074 Chr10:80244113..80244219 CGGTCAATGGTGTGCAGATA Chr10:80244215..80244234 60.54 50
downstream ENSMUSE00000665871 Chr10:80244113..80244219 CGGTCAATGGTGTGCAGATA Chr10:80244215..80244234 60.54 50
downstream ENSMUSE00000514213 Chr10:80244888..80244929 No primer for this exon
downstream ENSMUSE00000665870 Chr10:80244888..80244929 No primer for this exon
downstream ENSMUSE00000477341 Chr10:80245929..80246036 GCTCTTGTTCTCTCGCTGCT Chr10:80245979..80245998 60.04 55
downstream ENSMUSE00000665869 Chr10:80245929..80246036 GCTCTTGTTCTCTCGCTGCT Chr10:80245979..80245998 60.04 55
downstream ENSMUSE00000476329 Chr10:80246169..80246400 ATCCAGTGTGCTTTGGCTCT Chr10:80246357..80246376 59.87 50
downstream ENSMUSE00000665868 Chr10:80246169..80246400 ATCCAGTGTGCTTTGGCTCT Chr10:80246357..80246376 59.87 50
downstream ENSMUSE00000504719 Chr10:80246618..80246731 AGCTGGTAGAATGGGCTGTG Chr10:80246657..80246676 60.28 55
downstream ENSMUSE00000665867 Chr10:80246618..80246731 AGCTGGTAGAATGGGCTGTG Chr10:80246657..80246676 60.28 55
downstream ENSMUSE00000503962 Chr10:80247310..80247401 TGCGGGGTCTTTGTATAAGC Chr10:80247364..80247383 60.1 50
downstream ENSMUSE00000665866 Chr10:80247310..80247401 TGCGGGGTCTTTGTATAAGC Chr10:80247364..80247383 60.1 50
downstream ENSMUSE00000502955 Chr10:80247487..80247588 CCTGCGGATTTCTTCCTTTT Chr10:80247567..80247586 60.55 45
downstream ENSMUSE00000665865 Chr10:80247487..80247588 CCTGCGGATTTCTTCCTTTT Chr10:80247567..80247586 60.55 45
downstream ENSMUSE00000479143 Chr10:80247795..80247932 GAAGCTCGCTGTTGTCCTTC Chr10:80247915..80247934 60.14 55
downstream ENSMUSE00000665864 Chr10:80247795..80247932 GAAGCTCGCTGTTGTCCTTC Chr10:80247915..80247934 60.14 55
downstream ENSMUSE00000500654 Chr10:80248243..80248368 TTCTCTTTCCGCAGGTTCTC Chr10:80248316..80248335 59.55 50
downstream ENSMUSE00000665863 Chr10:80248243..80248368 TTCTCTTTCCGCAGGTTCTC Chr10:80248316..80248335 59.55 50
downstream ENSMUSE00000498875 Chr10:80248527..80249011 GACAACCGGGTGTAATCAGG Chr10:80248930..80248949 60.23 55
downstream ENSMUSE00000665862 Chr10:80248527..80249011 GACAACCGGGTGTAATCAGG Chr10:80248930..80248949 60.23 55
downstream ENSMUSE00000505713 Chr10:80249099..80249234 GCTTCATGCTGTTGGACAAG Chr10:80249166..80249185 59.44 50
downstream ENSMUSE00000665861 Chr10:80249099..80249234 GCTTCATGCTGTTGGACAAG Chr10:80249166..80249185 59.44 50
downstream ENSMUSE00000498486 Chr10:80249749..80249895 GTAGGCTGGTGATGGTCTCC Chr10:80249803..80249822 59.53 60
downstream ENSMUSE00000665860 Chr10:80249749..80249895 GTAGGCTGGTGATGGTCTCC Chr10:80249803..80249822 59.53 60
downstream ENSMUSE00000495770 Chr10:80250579..80250708 No primer for this exon
downstream ENSMUSE00000665859 Chr10:80250579..80250708 No primer for this exon
downstream ENSMUSE00000494707 Chr10:80251260..80251837 GCTGAGGCTAGGTGTTCCAG Chr10:80251750..80251769 60.01 60
downstream ENSMUSE00000609643 Chr10:80251260..80251837 GCTGAGGCTAGGTGTTCCAG Chr10:80251750..80251769 60.01 60
downstream ENSMUSE00000501670 Chr10:80252059..80252264 GTCCTAGAGGCCGTTCCTTC Chr10:80252191..80252210 60.21 60
downstream ENSMUSE00000665858 Chr10:80252059..80252264 GTCCTAGAGGCCGTTCCTTC Chr10:80252191..80252210 60.21 60
downstream ENSMUSE00000462855 Chr10:80253065..80253129 AGTGTCTTCGGGGGAGATTT Chr10:80253124..80253143 59.94 50
downstream ENSMUSE00000665857 Chr10:80253065..80253129 AGTGTCTTCGGGGGAGATTT Chr10:80253124..80253143 59.94 50
downstream ENSMUSE00000461103 Chr10:80253356..80254306 GTTGATAGGCTCGCTCGAAG Chr10:80253408..80253427 60.12 55
downstream ENSMUSE00000665856 Chr10:80253356..80254306 GTTGATAGGCTCGCTCGAAG Chr10:80253408..80253427 60.12 55
downstream ENSMUSE00000574719 Chr10:80254888..80255483 AGCACTGGCTCAGGGTTAGA Chr10:80255197..80255216 60.01 55
downstream ENSMUSE00000609640 Chr10:80254888..80255518 AGCACTGGCTCAGGGTTAGA Chr10:80255197..80255216 60.01 55
downstream ENSMUSE00000609639 Chr10:80256252..80257136 CAGGGTTAACAGTGGGGTGT Chr10:80256798..80256817 59.74 55
downstream ENSMUSE00000665875 Chr10:80256252..80257092 CAGGGTTAACAGTGGGGTGT Chr10:80256798..80256817 59.74 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGGTCACTCCCACTGGATT Chr10:80231439..80231459 59.96 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGGTCACTCCCACTGGATT Chr10:80231439..80231459 59.96 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000061589