Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI37694
Trapped Gene
Pmpca (ENSMUSG00000026926)
Vector Insertion
Chr 2: 26244953 - 26245455
Public Clones (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 5% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000164359 (Chr2:26244868..26244952 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000164359 (Chr2:26244868..26244952 +)
Downstram Exon
ENSMUSE00000164361 (Chr2:26245456..26245658 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon CACTGCTGAACCGTCTGTGT Chr2:26245493..26245512 59.94 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000164359 Chr2:26244868..26244952 No primer for this exon
upstream ENSMUSE00000698125 Chr2:26244874..26244952 No primer for this exon

*** Putative Vector Insertion (Chr 2: 26244953 - 26245455) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000164361 Chr2:26245456..26245658 CACTGCTGAACCGTCTGTGT Chr2:26245493..26245512 59.94 55
downstream ENSMUSE00000164352 Chr2:26245751..26245830 CGCTTCATATCGTGATCCTG Chr2:26245785..26245804 59.25 50
downstream ENSMUSE00000164356 Chr2:26246015..26246097 CTGTCAAATCGAGCAGTGGA Chr2:26246037..26246056 59.98 50
downstream ENSMUSE00000164354 Chr2:26246604..26246698 GAACCACATCAGCCAACAGA Chr2:26246683..26246702 59.68 50
downstream ENSMUSE00000164351 Chr2:26247386..26247486 GCCATCCTCGTCATCTCAAT Chr2:26247416..26247435 60.04 50
downstream ENSMUSE00000512564 Chr2:26247932..26248195 ATGCGGTCAGGGGTGTAGTA Chr2:26248053..26248072 60.4 55
downstream ENSMUSE00000513749 Chr2:26248426..26248518 CAGGAAGGAACAGCTCTCCA Chr2:26248521..26248540 60.52 55
downstream ENSMUSE00000164355 Chr2:26248606..26248724 CACAGCAAAGGGGATGAAGT Chr2:26248635..26248654 60.11 50
downstream ENSMUSE00000164358 Chr2:26248817..26248907 AATGCACAGGAGGCCTGTAT Chr2:26248886..26248905 59.58 50
downstream ENSMUSE00000164362 Chr2:26249038..26249100 CGTCCTGCCCATCAAGATAA Chr2:26249094..26249113 60.99 50
downstream ENSMUSE00000698106 Chr2:26249038..26249461 CCCCGCATTATTGTCTGTCT Chr2:26249273..26249292 59.96 50
downstream ENSMUSE00000164353 Chr2:26250545..26250689 CCCCACATCCTCAAAAATCA Chr2:26250634..26250653 60.69 45
downstream ENSMUSE00000485178 Chr2:26250939..26252641 CATCTAGTGGCCAGACAGCA Chr2:26251344..26251363 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGAGTTGCGTGACTGGGAAA Chr2:26244997..26245017 63.5 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000026926