Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI37697
Trapped Gene
Cdc42bpg (ENSMUSG00000024769)
Vector Insertion
Chr 19: 6306876 - 6309125
Public Clones (ggtc) (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 3% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000643852 (Chr19:6306716..6306875 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000643852 (Chr19:6306716..6306875 +)
Downstram Exon
ENSMUSE00000643850 (Chr19:6309126..6309217 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TCTGCCAATCACCTTCAAGA Chr19:6309205..6309224 59.37 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000643852 Chr19:6306716..6306875 No primer for this exon

*** Putative Vector Insertion (Chr 19: 6306876 - 6309125) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000643850 Chr19:6309126..6309217 TCTGCCAATCACCTTCAAGA Chr19:6309205..6309224 59.37 45
downstream ENSMUSE00000643849 Chr19:6309299..6309382 TCAGCCCTCTTCAGCATCTC Chr19:6309384..6309403 60.65 55
downstream ENSMUSE00000643848 Chr19:6309727..6309822 CTTCATCCTGGAAGGCGTAG Chr19:6309817..6309836 59.83 55
downstream ENSMUSE00000643847 Chr19:6310218..6310366 CCGCCAGCATAGTAGTCCAT Chr19:6310249..6310268 60.12 55
downstream ENSMUSE00000643846 Chr19:6310795..6310888 CAGGATGTTGTCAGGCTTCA Chr19:6310822..6310841 59.83 50
downstream ENSMUSE00000643845 Chr19:6311022..6311222 GACTCCCAGTGACCACCAGT Chr19:6311141..6311160 60.01 60
downstream ENSMUSE00000643844 Chr19:6311322..6311570 CAATCGACCCCTTCAAAGAA Chr19:6311473..6311492 60.04 45
downstream ENSMUSE00000643843 Chr19:6312118..6312197 TGCCTGAGGTGTAAGTGAAGC Chr19:6312198..6312218 60.45 52.38
downstream ENSMUSE00000643842 Chr19:6313219..6313316 TGAGCTCTGCACATCAAAGG Chr19:6313243..6313262 60.14 50
downstream ENSMUSE00000643841 Chr19:6313415..6313495 AAGCTCCTGGGGCTGTAATG Chr19:6313452..6313471 61.52 55
downstream ENSMUSE00000643839 Chr19:6313689..6313795 CTAGCATGGAGGCCATCAGT Chr19:6313746..6313765 60.24 55
downstream ENSMUSE00000643838 Chr19:6313891..6314070 GAATTCTTCCTGCCGGTTCT Chr19:6313971..6313990 60.58 50
downstream ENSMUSE00000643837 Chr19:6314285..6314365 TTGGCCTGTGAAGATTCTTGT Chr19:6314366..6314386 59.73 42.86
downstream ENSMUSE00000643836 Chr19:6314496..6314617 GATCCTATGCCGTTCGTCTC Chr19:6314536..6314555 59.66 55
downstream ENSMUSE00000643835 Chr19:6314705..6314780 CCTCCTCTTTCCCAACACTG Chr19:6314730..6314749 59.69 55
downstream ENSMUSE00000643833 Chr19:6314990..6315096 CTGAGGATGTCAGCGATCTG Chr19:6315096..6315115 59.53 55
downstream ENSMUSE00000233249 Chr19:6315172..6315286 TTCCTCAAGGACTCCAGCTC Chr19:6315255..6315274 59.53 55
downstream ENSMUSE00000233221 Chr19:6315639..6315787 CACGGATCTCAGCTTCCAGT Chr19:6315729..6315748 60.41 55
downstream ENSMUSE00000233190 Chr19:6315864..6315952 GGCCTGACTTTGCTTCTCAG Chr19:6315900..6315919 60.13 55
downstream ENSMUSE00000421163 Chr19:6316199..6316251 AGGGATGAGGGAAGTGGAAG Chr19:6316230..6316249 60.45 55
downstream ENSMUSE00000421159 Chr19:6316341..6316439 TTGGACCCTCTCCTGAATTG Chr19:6316386..6316405 60.04 50
downstream ENSMUSE00000232661 Chr19:6316519..6316578 No primer for this exon
downstream ENSMUSE00000233123 Chr19:6316829..6316934 GACACTTGGTAGGGGATGGA Chr19:6316883..6316902 59.78 55
downstream ENSMUSE00000233104 Chr19:6317161..6317294 TTGTGACGCACAAGCTGAGT Chr19:6317201..6317220 60.66 50
downstream ENSMUSE00000233083 Chr19:6317375..6317514 GAGGGTCAGGAGCATCAAAC Chr19:6317471..6317490 59.66 55
downstream ENSMUSE00000233057 Chr19:6317604..6317685 AGATACGTGGCAGGTCCTTG Chr19:6317683..6317702 60.13 55
downstream ENSMUSE00000233030 Chr19:6318358..6318574 CTTGGACGTGCATCCAGTAG Chr19:6318494..6318513 59.31 55
downstream ENSMUSE00000233007 Chr19:6320079..6320141 CACAAACAACCCCTCCTCAG Chr19:6320125..6320144 60.54 55
downstream ENSMUSE00000232981 Chr19:6320243..6320842 AGAACTTGGCGTTTGACTGC Chr19:6320489..6320508 60.44 50
downstream ENSMUSE00000232959 Chr19:6321657..6321754 AACACATCAAGGGCGTTTTC Chr19:6321711..6321730 59.98 45
downstream ENSMUSE00000232625 Chr19:6321827..6321911 CTTCTCGGTGCCATAAAGGA Chr19:6321880..6321899 60.21 50
downstream ENSMUSE00000232610 Chr19:6322027..6322147 CAGACACCCGGAAGAAGAAA Chr19:6322125..6322144 60.22 50
downstream ENSMUSE00000232589 Chr19:6322254..6322371 No primer for this exon
downstream ENSMUSE00000421108 Chr19:6322555..6322678 TTCTCCAGGGAGACCATCAC Chr19:6322671..6322690 60.05 55
downstream ENSMUSE00000421105 Chr19:6322793..6322881 TGATTCGCTGGACAGAGATG Chr19:6322836..6322855 59.94 50
downstream ENSMUSE00000417160 Chr19:6324517..6325650 AGTTCTCGGGTTTGGGTTCT Chr19:6325236..6325255 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGAGGGACGACAACATAATC Chr19:6306911..6306932 59.81 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AACACGTGACTGGGAAAACC Chr19:6306923..6306943 59.87 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024769