Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI37702
Trapped Gene
Clk3 (ENSMUSG00000032316)
Vector Insertion
Chr 9: 57606433 - 57608848
Public Clones (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 42% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000218641 (Chr9:57608631..57608847 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACTGTCACAAACGCCGTACC Chr9:57608655..57608674 61.02 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000218641 (Chr9:57608631..57608847 -)
Downstram Exon
ENSMUSE00000218647 (Chr9:57606434..57606530 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACTGTCACAAACGCCGTACC Chr9:57608655..57608674 61.02 55 CTGCGCTTACTGCTCTGTTG Chr9:57606483..57606502 59.95 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000444579 Chr9:57612881..57613324 GAAGAGACCTCCACCGATGT Chr9:57613091..57613110 59.1 55
upstream ENSMUSE00000348008 Chr9:57609523..57609674 GGGAGCATGAAGGTCGACTA Chr9:57609573..57609592 60.22 55
upstream ENSMUSE00000218641 Chr9:57608631..57608847 ACTGTCACAAACGCCGTACC Chr9:57608655..57608674 61.02 55
upstream ENSMUSE00000218647 Chr9:57606434..57606530 CGGAGTGTGGAAGATGACAA Chr9:57606481..57606500 59.68 50

*** Putative Vector Insertion (Chr 9: 57606433 - 57608848) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000218639 Chr9:57606091..57606157 No primer for this exon
downstream ENSMUSE00000218644 Chr9:57603059..57603175 GCCCACATTACGGATGATCT Chr9:57603111..57603130 59.78 50
downstream ENSMUSE00000218646 Chr9:57602309..57602475 TGACCATGGAAGTTGAACCA Chr9:57602412..57602431 59.94 45
downstream ENSMUSE00000218650 Chr9:57601308..57601402 GGTCAGCTGGTTCTCGTGTAG Chr9:57601358..57601378 59.92 57.14
downstream ENSMUSE00000218640 Chr9:57601078..57601207 CCACAATGGTGGTGTGATGT Chr9:57601092..57601111 60.14 50
downstream ENSMUSE00000218648 Chr9:57600452..57600534 ATGCAGCCGATACTCCAGAC Chr9:57600467..57600486 60.25 55
downstream ENSMUSE00000218638 Chr9:57599922..57600001 CTGGTACGGTGGATCATGTG Chr9:57599900..57599919 59.83 55
downstream ENSMUSE00000218645 Chr9:57599544..57599634 AGCTGTTCTCATCCCAAACC Chr9:57599563..57599582 59.14 50
downstream ENSMUSE00000517721 Chr9:57598518..57598928 CTCCAACTCTTCGTGTGCTG Chr9:57598699..57598718 59.62 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGTTAATCGCCTTGCAGCAC Chr9:57608780..57608800 60.42 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATCTTGCTACCCCCTCTTGG Chr9:57608849..57608869 60.46 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032316