Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI3772
Trapped Gene
Ddx50 (ENSMUSG00000020076)
Vector Insertion
Chr 10: 62079265 - 62082332
Public Clones XQ0382 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 88% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000272756 (Chr10:62082333..62082377 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000272756 (Chr10:62082333..62082377 -)
Downstram Exon
ENSMUSE00000272749 (Chr10:62078771..62079264 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000371783 Chr10:62113773..62113966 No primer for this exon
upstream ENSMUSE00000100390 Chr10:62109662..62109949 No primer for this exon
upstream ENSMUSE00000100388 Chr10:62106045..62106120 No primer for this exon
upstream ENSMUSE00000100389 Chr10:62105524..62105702 No primer for this exon
upstream ENSMUSE00000100385 Chr10:62103493..62103610 No primer for this exon
upstream ENSMUSE00000100386 Chr10:62103195..62103380 No primer for this exon
upstream ENSMUSE00000100392 Chr10:62102609..62102754 No primer for this exon
upstream ENSMUSE00000100391 Chr10:62096725..62096874 No primer for this exon
upstream ENSMUSE00000272787 Chr10:62090269..62090430 No primer for this exon
upstream ENSMUSE00000413879 Chr10:62088911..62089030 No primer for this exon
upstream ENSMUSE00000272779 Chr10:62087893..62087966 No primer for this exon
upstream ENSMUSE00000272771 Chr10:62087516..62087675 No primer for this exon
upstream ENSMUSE00000272763 Chr10:62084137..62084271 No primer for this exon
upstream ENSMUSE00000272756 Chr10:62082333..62082377 No primer for this exon

*** Putative Vector Insertion (Chr 10: 62079265 - 62082332) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000272749 Chr10:62078771..62079264 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTTGCTGGTGTGTGGGTTTA Chr10:62079301..62079321 59.61 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTTGCTGGTGTGTGGGTTTA Chr10:62079301..62079321 59.61 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020076