Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI37731
Trapped Gene
Mcm3 (ENSMUSG00000041859)
Vector Insertion
Chr 1: 20807873 - 20810307
Public Clones (sanger) (sanger) (sanger) (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 3% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000355532 (Chr1:20810212..20810306 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGCACAGTAGTGCTGGATGA Chr1:20810264..20810283 59.86 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000355532 (Chr1:20810212..20810306 -)
Downstram Exon
ENSMUSE00000308240 (Chr1:20807874..20807986 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGCACAGTAGTGCTGGATGA Chr1:20810264..20810283 59.86 55 CCCGAACCTTGTTCTGGTAA Chr1:20807931..20807950 59.96 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000355532 Chr1:20810212..20810306 GGCACAGTAGTGCTGGATGA Chr1:20810264..20810283 59.86 55
upstream ENSMUSE00000308240 Chr1:20807874..20807986 GAACAAGGTTCGGGAACTGA Chr1:20807947..20807966 60.09 50

*** Putative Vector Insertion (Chr 1: 20807873 - 20810307) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000308232 Chr1:20807324..20807532 AGCTCCTCAAACGCATTGTT Chr1:20807484..20807503 59.88 45
downstream ENSMUSE00000308225 Chr1:20806730..20806860 GAAAGCCACTAGGGTGGTGA Chr1:20806735..20806754 60.11 55
downstream ENSMUSE00000308216 Chr1:20804770..20805008 GGTGATGGTCTGATGGTCCT Chr1:20804918..20804937 59.77 55
downstream ENSMUSE00000308208 Chr1:20804480..20804588 ATATCGTCCGCAGAGAATGC Chr1:20804495..20804514 60.21 50
downstream ENSMUSE00000308199 Chr1:20803042..20803195 TTGATGTCTCCACGGATGTG Chr1:20803034..20803053 60.53 50
downstream ENSMUSE00000604364 Chr1:20802645..20802776 AGCTGTGAGACCCACTCCAG Chr1:20802648..20802667 60.46 60
downstream ENSMUSE00000604363 Chr1:20802046..20802254 AGCCTTTGCAATGGTCACTC Chr1:20802090..20802109 60.26 50
downstream ENSMUSE00000552279 Chr1:20800139..20800313 TCTGAGATCTCCCGATCCTG Chr1:20800170..20800189 60.3 55
downstream ENSMUSE00000308175 Chr1:20799677..20799803 CTGTGGCCAGGATATCCACT Chr1:20799743..20799762 59.95 55
downstream ENSMUSE00000604362 Chr1:20798802..20798952 TTCTGCAATGTAGGCTGCTG Chr1:20798831..20798850 60.16 50
downstream ENSMUSE00000308157 Chr1:20796823..20796963 GTGGCCAGTCGAATCAGAGT Chr1:20796892..20796911 60.27 55
downstream ENSMUSE00000308147 Chr1:20795878..20795981 CTTTTCCGCTTCTGCTCAGT Chr1:20795856..20795875 59.76 50
downstream ENSMUSE00000308137 Chr1:20795344..20795420 CCATCCTTGGCATGAGTCTT Chr1:20795375..20795394 60.07 50
downstream ENSMUSE00000308126 Chr1:20794898..20794988 TCCACTTTCTGGGAGTCCTG Chr1:20794891..20794910 60.23 55
downstream ENSMUSE00000396520 Chr1:20793096..20793735 TAACAAACGCAGGACACAGC Chr1:20793257..20793276 59.91 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGCACAGTAGTGCTGGATGA Chr1:20810262..20810282 59.86 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGATGATGTGGACGTGACTG Chr1:20810248..20810268 59.96 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000041859