Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI37774
Trapped Gene
Myom1 (ENSMUSG00000024049)
Vector Insertion
Chr 17: 71384052 - 71385613
Public Clones (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 10% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000455127 (Chr17:71383911..71384051 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGGCAACTACCTGGTGCCTA Chr17:71384019..71384038 59.76 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000455127 (Chr17:71383911..71384051 +)
Downstram Exon
ENSMUSE00000455121 (Chr17:71385614..71385863 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGGCAACTACCTGGTGCCTA Chr17:71384019..71384038 59.76 55 CCTCACTCGCAAGGAGAGTC Chr17:71385711..71385730 60.13 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000606356 Chr17:71368861..71368991 TCTCTCCTGCTCCTCGACTG Chr17:71368933..71368952 60.84 60
upstream ENSMUSE00000455132 Chr17:71372188..71372537 GTCAAGCATCAGCCACCTCT Chr17:71372399..71372418 60.42 55
upstream ENSMUSE00000455127 Chr17:71383911..71384051 AGGCAACTACCTGGTGCCTA Chr17:71384019..71384038 59.76 55

*** Putative Vector Insertion (Chr 17: 71384052 - 71385613) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000455121 Chr17:71385614..71385863 CCTCACTCGCAAGGAGAGTC Chr17:71385711..71385730 60.13 60
downstream ENSMUSE00000390502 Chr17:71386556..71386713 GCCGTGATATGTTTGGGTCT Chr17:71386585..71386604 59.82 50
downstream ENSMUSE00000238167 Chr17:71393826..71393918 CCGTATCGGCTTTCAATGAT Chr17:71393897..71393916 59.92 45
downstream ENSMUSE00000475939 Chr17:71394884..71394972 CCCGGTACTGAGCTGTGTCT Chr17:71394918..71394937 60.32 60
downstream ENSMUSE00000238129 Chr17:71395077..71395136 ACCACGGAGGAGAGACTCAT Chr17:71395117..71395136 58.69 55
downstream ENSMUSE00000482908 Chr17:71397064..71397228 TAACCGTAAGGGGTCACAGC Chr17:71397088..71397107 59.99 55
downstream ENSMUSE00000238085 Chr17:71401954..71402115 GCACCCATTTTGATGGAGAA Chr17:71401986..71402005 60.84 45
downstream ENSMUSE00000238057 Chr17:71410465..71410606 GCTCCTTCGATCTCTGCATC Chr17:71410492..71410511 60.06 55
downstream ENSMUSE00000238040 Chr17:71413788..71413987 GGAAACCGAGCAAACTTCAC Chr17:71413856..71413875 59.72 50
downstream ENSMUSE00000540317 Chr17:71416653..71416709 AGGCTCTTCTTCCGTGACAA Chr17:71416708..71416727 59.99 50
downstream ENSMUSE00000359374 Chr17:71421423..71421547 GGGTTTCCAGCTCAGCACTA Chr17:71421505..71421524 60.4 55
downstream ENSMUSE00000237971 Chr17:71426597..71426780 CAGAGCAAAGCGAGGAGACT Chr17:71426671..71426690 59.89 55
downstream ENSMUSE00000480938 Chr17:71427105..71427279 CCTTCACCGGGTTGTTATTG Chr17:71427275..71427294 60.22 50
downstream ENSMUSE00000237936 Chr17:71430114..71430235 GAGCAGTCGTCAGTCCATGA Chr17:71430145..71430164 59.99 55
downstream ENSMUSE00000455067 Chr17:71431543..71431836 AGTCCACCAGGCGTATCACT Chr17:71431600..71431619 59.6 55
downstream ENSMUSE00000477722 Chr17:71433578..71433774 TTCCTGGTACCTCACCAACC Chr17:71433730..71433749 59.82 55
downstream ENSMUSE00000137593 Chr17:71436784..71436910 ACACTTGAAGCACTCGCTCA Chr17:71436888..71436907 59.78 50
downstream ENSMUSE00000137612 Chr17:71439163..71439347 TTAAGTCCTCGCCATTGGTC Chr17:71439319..71439338 60.07 50
downstream ENSMUSE00000137595 Chr17:71441440..71441554 CACGGAACACGTAGCTGGTA Chr17:71441482..71441501 59.78 55
downstream ENSMUSE00000137613 Chr17:71449294..71449450 CCGTCATCATCCACACTCAC Chr17:71449333..71449352 59.96 55
downstream ENSMUSE00000137605 Chr17:71450334..71450440 CAAATCATCTGTCCCGAGGT Chr17:71450376..71450395 59.93 50
downstream ENSMUSE00000137591 Chr17:71450564..71450608 GGCAAGCAGACGTTTCATTT Chr17:71450586..71450605 60.26 45
downstream ENSMUSE00000137603 Chr17:71454803..71454939 AAACCGGACCTGACCTTTCT Chr17:71454864..71454883 59.97 50
downstream ENSMUSE00000137615 Chr17:71455544..71455688 CCCTTCATCCTCGTCCTGTA Chr17:71455624..71455643 60.06 55
downstream ENSMUSE00000137589 Chr17:71457641..71457700 ATCCATTCTTGTCGCTGGAA Chr17:71457692..71457711 60.6 45
downstream ENSMUSE00000518451 Chr17:71457966..71458033 TTGCATTTCAACAGCACGTT Chr17:71458035..71458054 60.3 40
downstream ENSMUSE00000358518 Chr17:71459067..71459180 AGCAGGGTACAAATGCCATC Chr17:71459173..71459192 59.96 50
downstream ENSMUSE00000473350 Chr17:71460047..71460134 AATCCAGCGTCTTTCTTGGA Chr17:71460072..71460091 59.81 45
downstream ENSMUSE00000540309 Chr17:71461151..71461189 No primer for this exon
downstream ENSMUSE00000377703 Chr17:71461284..71461389 TCTGGATTTTCAGGTCTGTGG Chr17:71461315..71461335 60.1 47.62
downstream ENSMUSE00000137599 Chr17:71466634..71466797 TCACGCCACTCTTGACTCTG Chr17:71466680..71466699 60.18 55
downstream ENSMUSE00000137607 Chr17:71469986..71470022 CCTCTGGAATTCAGCAAAGG Chr17:71470020..71470039 59.81 50
downstream ENSMUSE00000692589 Chr17:71470466..71470488 TTTTTCAGCAATGGCAGCTT Chr17:71470490..71470509 60.89 40
downstream ENSMUSE00000487050 Chr17:71471897..71471952 CAACATCAGGGAGACCACCT Chr17:71471935..71471954 59.96 55
downstream ENSMUSE00000484873 Chr17:71475416..71476195 GTGGCTTCTCGTTTTTCAGC Chr17:71475491..71475510 60 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGGCAACTACCTGGTGCCTA Chr17:71384020..71384040 59.76 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGGCAACTACCTGGTGCCTA Chr17:71384020..71384040 59.76 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024049