Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI37785
Trapped Gene
Ccnb1 (ENSMUSG00000041431)
Vector Insertion
Chr 13: 101549976 - 101550872
Public Clones (ggtc) (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 80% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000519338 (Chr13:101550731..101550871 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CATGCTGGACTACGACATGG Chr13:101550805..101550824 60.14 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000519338 (Chr13:101550731..101550871 -)
Downstram Exon
ENSMUSE00000496967 (Chr13:101549977..101550087 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CATGCTGGACTACGACATGG Chr13:101550805..101550824 60.14 55 CAGGTGCTGCATAACAGGAA Chr13:101550000..101550019 59.86 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000679930 Chr13:101556337..101556451 ATCGGGGAACCTCTGATTTT Chr13:101556367..101556386 59.77 45
upstream ENSMUSE00000506016 Chr13:101555688..101555858 AGGCAAGAGTGCCTCTGAAA Chr13:101555691..101555710 60.13 50
upstream ENSMUSE00000492616 Chr13:101555412..101555573 ACCAGAGGTGGAACTTGCTG Chr13:101555477..101555496 60.3 55
upstream ENSMUSE00000491666 Chr13:101553420..101553602 GTGCGCCTGCAGAAGAGTAT Chr13:101553543..101553562 60.57 55
upstream ENSMUSE00000518252 Chr13:101551580..101551738 AGGGTCGTGAAGTGACTGGA Chr13:101551688..101551707 60.71 55
upstream ENSMUSE00000520226 Chr13:101551113..101551349 CTGCACTTCCTCCGTAGAGC Chr13:101551129..101551148 60.16 60
upstream ENSMUSE00000519338 Chr13:101550731..101550871 CATGCTGGACTACGACATGG Chr13:101550805..101550824 60.14 55
upstream ENSMUSE00000496967 Chr13:101549977..101550087 TTCCTGTTATGCAGCACCTG Chr13:101550022..101550041 59.86 50

*** Putative Vector Insertion (Chr 13: 101549976 - 101550872) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000569255 Chr13:101548702..101549740 ACTTGGGGGCAAATTCTTTT Chr13:101549112..101549131 59.81 40

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGTGGTCTGTTCCAGGTTGA Chr13:101550865..101550885 60.13 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGTGGTCTGTTCCAGGTTGA Chr13:101550865..101550885 60.13 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000041431