Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI37794
Trapped Gene
Igf2bp3 (ENSMUSG00000029814)
Vector Insertion
Chr 6: 49044138 - 49054299
Public Clones (sanger) (sanger) (sanger) (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 70% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000193029 (Chr6:49054173..49054298 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTGAATGCCTTGGGTCTGTT Chr6:49054249..49054268 60.11 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000193029 (Chr6:49054173..49054298 -)
Downstram Exon
ENSMUSE00000193026 (Chr6:49044139..49044255 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTGAATGCCTTGGGTCTGTT Chr6:49054249..49054268 60.11 50 GCGGGAATAAACAGATGCAC Chr6:49044196..49044215 60.48 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000473559 Chr6:49164296..49164956 CATTCAAAAAGCCGGACACT Chr6:49164920..49164939 60.11 45
upstream ENSMUSE00000292807 Chr6:49163266..49163326 AGTTGAGCACTCGGTCCCTA Chr6:49163276..49163295 59.87 55
upstream ENSMUSE00000292799 Chr6:49118469..49118517 AAATATCCCGCCCCACTTAC Chr6:49118477..49118496 60.04 50
upstream ENSMUSE00000292793 Chr6:49084846..49084897 AGTGGTGGAGAGCTGTGAGC Chr6:49084849..49084868 60.62 60
upstream ENSMUSE00000292786 Chr6:49084694..49084757 ATTCGGAAACGGCAGTTGTA Chr6:49084729..49084748 60.5 45
upstream ENSMUSE00000292782 Chr6:49067151..49067432 ACCATTCGCAACATCACAAA Chr6:49067166..49067185 59.97 40
upstream ENSMUSE00000193031 Chr6:49058925..49059059 CGATGTCCATCGTAAGGAGAA Chr6:49059036..49059056 60.08 47.62
upstream ENSMUSE00000193028 Chr6:49057341..49057463 GGCCGTCTCATTGGTAAAGA Chr6:49057398..49057417 60.07 50
upstream ENSMUSE00000193030 Chr6:49055569..49055704 AGGCAGTGTTGAGACGTGTG Chr6:49055637..49055656 59.94 55
upstream ENSMUSE00000193029 Chr6:49054173..49054298 CTGAATGCCTTGGGTCTGTT Chr6:49054249..49054268 60.11 50
upstream ENSMUSE00000193026 Chr6:49044139..49044255 AAACAGCTTTCTCGCTTTGC Chr6:49044155..49044174 59.78 45

*** Putative Vector Insertion (Chr 6: 49044138 - 49054299) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000498311 Chr6:49040975..49041049 ATCACCATCCGCACTTTAGC Chr6:49040984..49041003 60.1 50
downstream ENSMUSE00000193027 Chr6:49038429..49038560 AAAGGACGGCACTCTGATGT Chr6:49038443..49038462 59.73 50
downstream ENSMUSE00000193033 Chr6:49037767..49037880 GGGACGACAACTTCAGCACT Chr6:49037815..49037834 60.31 55
downstream ENSMUSE00000388923 Chr6:49035227..49037439 GATCACCCGCACCTACAAGT Chr6:49035857..49035876 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGTGCTAACGTTAAGCCTTCC Chr6:49051254..49051275 60.14 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGTGCTAACGTTAAGCCTTCC Chr6:49051254..49051275 60.14 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029814