Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI37795
Trapped Gene
Agpat6 (ENSMUSG00000031545)
Vector Insertion
Chr 8: 24285979 - 24289973
Public Clones (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 77% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000523328 (Chr8:24289887..24289972 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCACTGTTTACCCTGTGGCTA Chr8:24289892..24289912 60.04 52.38 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000523328 (Chr8:24289887..24289972 -)
Downstram Exon
ENSMUSE00000523327 (Chr8:24285980..24286108 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCACTGTTTACCCTGTGGCTA Chr8:24289892..24289912 60.04 52.38 GTACCAAACGCTGCAGACAA Chr8:24285979..24285998 59.91 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000449884 Chr8:24318771..24318833 GCAGTCACCGAGGACTGGAG Chr8:24318787..24318806 63.39 65
upstream ENSMUSE00000449870 Chr8:24301188..24302164 GGACAAATTTACCCGCTGAA Chr8:24301709..24301728 59.94 45
upstream ENSMUSE00000449859 Chr8:24295001..24295070 GAGGAGCCAAGGAGAGGAAC Chr8:24295029..24295048 60.34 60
upstream ENSMUSE00000343846 Chr8:24293135..24293435 GCTGATTCGGTATTGCTTCC Chr8:24293148..24293167 59.67 50
upstream ENSMUSE00000210602 Chr8:24292245..24292319 GGTTGGATACCTGCCAAATG Chr8:24292249..24292268 60.19 50
upstream ENSMUSE00000449839 Chr8:24291332..24291421 GACGGCCATCATTACGTACC Chr8:24291339..24291358 60.22 55
upstream ENSMUSE00000449836 Chr8:24291105..24291198 AACCATACATCCCCCATTGA Chr8:24291142..24291161 59.87 45
upstream ENSMUSE00000523329 Chr8:24290573..24290688 TTGAGCGTTCTGAGGTGAAA Chr8:24290596..24290615 59.57 45
upstream ENSMUSE00000355485 Chr8:24290241..24290296 ATAAAAGCAAGCTGCCCATC Chr8:24290257..24290276 59.32 45
upstream ENSMUSE00000523328 Chr8:24289887..24289972 CCACTGTTTACCCTGTGGCTA Chr8:24289892..24289912 60.04 52.38
upstream ENSMUSE00000523327 Chr8:24285980..24286108 GGCATGGTGACGTACCTTCT Chr8:24286044..24286063 60 55

*** Putative Vector Insertion (Chr 8: 24285979 - 24289973) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000399554 Chr8:24285812..24285891 GGCAATGGCAGACTTCACTC Chr8:24285819..24285838 60.81 55
downstream ENSMUSE00000449866 Chr8:24284207..24285132 GGAGTCCAGAACAGCCTGAG Chr8:24284854..24284873 59.99 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTTCTTGCCTGTGTTTCAGG Chr8:24289970..24289990 58.9 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCCTCATTGAGACCGTGACT Chr8:24289915..24289935 60.11 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031545