Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI37797
Trapped Gene
Ncoa6 (ENSMUSG00000038369)
Vector Insertion
Chr 2: 155266423 - 155275088
Public Clones (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000681156 (Chr2:155275019..155275087 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGGAGAGGGGTCCTATTGACT Chr2:155275054..155275074 59.94 52.38 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000681156 (Chr2:155275019..155275087 -)
Downstram Exon
ENSMUSE00000681155 (Chr2:155266424..155266521 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGGAGAGGGGTCCTATTGACT Chr2:155275054..155275074 59.94 52.38 AGGTGGCATCTTTAGGGCTTA Chr2:155266451..155266471 60.1 47.62

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000681157 Chr2:155299376..155299542 No primer for this exon
upstream ENSMUSE00000681156 Chr2:155275019..155275087 TGGAGAGGGGTCCTATTGACT Chr2:155275054..155275074 59.94 52.38
upstream ENSMUSE00000487003 Chr2:155266424..155266519 GCCACCTTGCTTGGACTTAG Chr2:155266460..155266479 59.88 55
upstream ENSMUSE00000681155 Chr2:155266424..155266521 GCCACCTTGCTTGGACTTAG Chr2:155266460..155266479 59.88 55

*** Putative Vector Insertion (Chr 2: 155266423 - 155275088) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000490064 Chr2:155263596..155263875 TGAGTCGCCCATTGTAGATG Chr2:155263737..155263756 59.67 50
downstream ENSMUSE00000710606 Chr2:155263596..155263875 TGAGTCGCCCATTGTAGATG Chr2:155263737..155263756 59.67 50
downstream ENSMUSE00000325892 Chr2:155259669..155259824 AAGCTGCTGGTTGTTGCTCT Chr2:155259681..155259700 60.2 50
downstream ENSMUSE00000325888 Chr2:155258552..155258674 GCCACAGGTCCATTCATTCT Chr2:155258583..155258602 59.93 50
downstream ENSMUSE00000325883 Chr2:155248547..155248675 CAGGGCTCGTCATCCTTATT Chr2:155248630..155248649 59.15 50
downstream ENSMUSE00000467535 Chr2:155246703..155247605 GAACAGGCTGCATTGAGTGA Chr2:155247488..155247507 59.99 50
downstream ENSMUSE00000681152 Chr2:155246013..155247605 GAACAGGCTGCATTGAGTGA Chr2:155247488..155247507 59.99 50
downstream ENSMUSE00000325874 Chr2:155244614..155244760 CTGACCTTGCATGAAGTTGG Chr2:155244671..155244690 59.29 50
downstream ENSMUSE00000325869 Chr2:155240548..155241664 TGTCCTGTGAATTGCACCAT Chr2:155241036..155241055 59.97 45
downstream ENSMUSE00000325865 Chr2:155237261..155237382 No primer for this exon
downstream ENSMUSE00000356079 Chr2:155231211..155234186 GACTTGCCCGTTTTGTTGTT Chr2:155233103..155233122 60.01 45
downstream ENSMUSE00000325850 Chr2:155228408..155228476 GGAGTTTCCTTTGGGGCTAA Chr2:155228421..155228440 60.42 50
downstream ENSMUSE00000325844 Chr2:155225391..155225427 AGAGGCTATGGCAGCATTTG Chr2:155225377..155225396 60.37 50
downstream ENSMUSE00000325836 Chr2:155221456..155221607 AGAGTTTCTTCGGCTCGTCA Chr2:155221528..155221547 60.13 50
downstream ENSMUSE00000325828 Chr2:155216405..155216956 AGGAAAAGGACCGCGTTATT Chr2:155216767..155216786 59.97 45
downstream ENSMUSE00000681153 Chr2:155216401..155216956 AGGAAAAGGACCGCGTTATT Chr2:155216767..155216786 59.97 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGTTTTCTAATCGCCTTGCAG Chr2:155272023..155272044 60.38 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTTCCGTGACTGGGAAAACC Chr2:155272021..155272041 62.17 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038369