Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI378
Trapped Gene
AC124987.9 (ENSMUSG00000074175)
Vector Insertion
Chr 3: 146032208 - 146040386
Public Clones GC1120 (tigem)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000668801 (Chr3:146040387..146040491 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AATTGGGCAAGACAGTTGTG Chr3:146040414..146040433 58.62 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000668801 (Chr3:146040387..146040491 -)
Downstram Exon
ENSMUSE00000635324 (Chr3:146030117..146032207 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AATTGGGCAAGACAGTTGTG Chr3:146040414..146040433 58.62 45 GTTCTCAACCGTCCCAGTGT Chr3:146032065..146032084 60.01 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000668802 Chr3:146041686..146041908 CGCCTGCTCAAGCTCTTACT Chr3:146041737..146041756 59.92 55
upstream ENSMUSE00000668801 Chr3:146040387..146040491 AATTGGGCAAGACAGTTGTG Chr3:146040414..146040433 58.62 45

*** Putative Vector Insertion (Chr 3: 146032208 - 146040386) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000635324 Chr3:146030117..146032207 GTTCTCAACCGTCCCAGTGT Chr3:146032065..146032084 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr3:146037316..146037336 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCCCAGGCAACTGAACATAC Chr3:146037338..146037358 60.38 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000074175