Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI37805
Trapped Gene
Leo1 (ENSMUSG00000042487)
Vector Insertion
Chr 9: 75296204 - 75297163
Public Clones (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 51% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000275823 (Chr9:75296109..75296203 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCGGAGGTGCAGATGACATA Chr9:75296133..75296152 60.22 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000275823 (Chr9:75296109..75296203 +)
Downstram Exon
ENSMUSE00000275792 (Chr9:75297164..75297309 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCGGAGGTGCAGATGACATA Chr9:75296133..75296152 60.22 50 TGGTCTCAGGTATGGGCTCT Chr9:75297221..75297240 59.68 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000275902 Chr9:75289331..75289442 GGACATGGAGGACCTCTTCG Chr9:75289390..75289409 61.99 60
upstream ENSMUSE00000275864 Chr9:75293042..75293800 GGTGTCCGATGAGGAGAAAA Chr9:75293694..75293713 60.05 50
upstream ENSMUSE00000275844 Chr9:75294909..75295013 TTACGACTGAAGCGCAAGAA Chr9:75294944..75294963 59.75 45
upstream ENSMUSE00000275823 Chr9:75296109..75296203 TCGGAGGTGCAGATGACATA Chr9:75296133..75296152 60.22 50

*** Putative Vector Insertion (Chr 9: 75296204 - 75297163) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000275792 Chr9:75297164..75297309 TGGTCTCAGGTATGGGCTCT Chr9:75297221..75297240 59.68 55
downstream ENSMUSE00000275694 Chr9:75298295..75298379 CCCTCTTCATCCAGCATCTC Chr9:75298360..75298379 59.76 55
downstream ENSMUSE00000275665 Chr9:75302431..75302525 TCCATCTGACCACTTGACGA Chr9:75302526..75302545 60.25 50
downstream ENSMUSE00000275637 Chr9:75303448..75303582 TTCCCTAAATGCAGGGACAT Chr9:75303471..75303490 59.39 45
downstream ENSMUSE00000275621 Chr9:75304865..75305000 GCCAGCCATTGGTAAGATTC Chr9:75304967..75304986 59.53 50
downstream ENSMUSE00000275602 Chr9:75305882..75306068 CCCCTTTGTAGCGGTTTTTA Chr9:75306062..75306081 59.12 45
downstream ENSMUSE00000275582 Chr9:75308813..75308910 GTCTTCTTCGGAGCCCTCAT Chr9:75308868..75308887 60.74 55
downstream ENSMUSE00000363177 Chr9:75314001..75314239 TTGTCATCGTCTTCCGCTTT Chr9:75314047..75314066 60.78 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGAGAAGATAAGCCCCCAAC Chr9:75296169..75296189 59.9 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGAGAAGATAAGCCCCCAAC Chr9:75296169..75296189 59.9 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000042487