Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI37818
Trapped Gene
Ccnb1 (ENSMUSG00000041431)
Vector Insertion
Chr 13: 101551112 - 101551739
Public Clones (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 46% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000518252 (Chr13:101551580..101551738 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGGGTCGTGAAGTGACTGGA Chr13:101551688..101551707 60.71 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000518252 (Chr13:101551580..101551738 -)
Downstram Exon
ENSMUSE00000520226 (Chr13:101551113..101551349 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGGGTCGTGAAGTGACTGGA Chr13:101551688..101551707 60.71 55 GCTCTACGGAGGAAGTGCAG Chr13:101551107..101551126 60.16 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000679930 Chr13:101556337..101556451 ATCGGGGAACCTCTGATTTT Chr13:101556367..101556386 59.77 45
upstream ENSMUSE00000506016 Chr13:101555688..101555858 AGGCAAGAGTGCCTCTGAAA Chr13:101555691..101555710 60.13 50
upstream ENSMUSE00000492616 Chr13:101555412..101555573 ACCAGAGGTGGAACTTGCTG Chr13:101555477..101555496 60.3 55
upstream ENSMUSE00000491666 Chr13:101553420..101553602 GTGCGCCTGCAGAAGAGTAT Chr13:101553543..101553562 60.57 55
upstream ENSMUSE00000518252 Chr13:101551580..101551738 AGGGTCGTGAAGTGACTGGA Chr13:101551688..101551707 60.71 55
upstream ENSMUSE00000520226 Chr13:101551113..101551349 CTGCACTTCCTCCGTAGAGC Chr13:101551129..101551148 60.16 60

*** Putative Vector Insertion (Chr 13: 101551112 - 101551739) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000519338 Chr13:101550731..101550871 GCAAAATGCACCATGTCGTA Chr13:101550773..101550792 60.53 45
downstream ENSMUSE00000496967 Chr13:101549977..101550087 CAGGTGCTGCATAACAGGAA Chr13:101550000..101550019 59.86 50
downstream ENSMUSE00000569255 Chr13:101548702..101549740 ACTTGGGGGCAAATTCTTTT Chr13:101549112..101549131 59.81 40

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACAGGGTCGTGAAGTGACTG Chr13:101551688..101551708 58.72 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACAGGGTCGTGAAGTGACTG Chr13:101551688..101551708 58.72 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000041431