Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI37828
Trapped Gene
AA986860 (ENSMUSG00000042510)
Vector Insertion
Chr 1: 132634265 - 132637579
Public Clones (ggtc) (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 6% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000253158 (Chr1:132634079..132634264 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGGGACATTCTTCACTTCCA Chr1:132634087..132634106 59.06 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000253158 (Chr1:132634079..132634264 +)
Downstram Exon
ENSMUSE00000253152 (Chr1:132637580..132637760 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGGGACATTCTTCACTTCCA Chr1:132634087..132634106 59.06 45 GAGCCAATGGTTTTCTCCAG Chr1:132637656..132637675 59.67 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000454434 Chr1:132628663..132628800 GTAGGAGACACGGCCTGAGA Chr1:132628705..132628724 60.41 60
upstream ENSMUSE00000253158 Chr1:132634079..132634264 TGGGACATTCTTCACTTCCA Chr1:132634087..132634106 59.06 45

*** Putative Vector Insertion (Chr 1: 132634265 - 132637579) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000253152 Chr1:132637580..132637760 GAGCCAATGGTTTTCTCCAG Chr1:132637656..132637675 59.67 50
downstream ENSMUSE00000377180 Chr1:132638906..132641198 CTGTGTCCGGGAACTGTTTT Chr1:132640002..132640021 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGTGCTGTTGGCCTTTACA Chr1:132634218..132634238 59.9 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGCTGTGCTGTTGGCCTTTA Chr1:132637216..132637236 60.96 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000042510